ID: 1111143274

View in Genome Browser
Species Human (GRCh38)
Location 13:84150115-84150137
Sequence GTGTTTTGAGCTTTATGTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111143270_1111143274 1 Left 1111143270 13:84150091-84150113 CCCAACAGTAGTCCCAAGTTTCT No data
Right 1111143274 13:84150115-84150137 GTGTTTTGAGCTTTATGTCCAGG No data
1111143267_1111143274 4 Left 1111143267 13:84150088-84150110 CCCCCCAACAGTAGTCCCAAGTT No data
Right 1111143274 13:84150115-84150137 GTGTTTTGAGCTTTATGTCCAGG No data
1111143271_1111143274 0 Left 1111143271 13:84150092-84150114 CCAACAGTAGTCCCAAGTTTCTA No data
Right 1111143274 13:84150115-84150137 GTGTTTTGAGCTTTATGTCCAGG No data
1111143266_1111143274 7 Left 1111143266 13:84150085-84150107 CCTCCCCCCAACAGTAGTCCCAA No data
Right 1111143274 13:84150115-84150137 GTGTTTTGAGCTTTATGTCCAGG No data
1111143269_1111143274 2 Left 1111143269 13:84150090-84150112 CCCCAACAGTAGTCCCAAGTTTC No data
Right 1111143274 13:84150115-84150137 GTGTTTTGAGCTTTATGTCCAGG No data
1111143268_1111143274 3 Left 1111143268 13:84150089-84150111 CCCCCAACAGTAGTCCCAAGTTT No data
Right 1111143274 13:84150115-84150137 GTGTTTTGAGCTTTATGTCCAGG No data
1111143265_1111143274 13 Left 1111143265 13:84150079-84150101 CCACTTCCTCCCCCCAACAGTAG No data
Right 1111143274 13:84150115-84150137 GTGTTTTGAGCTTTATGTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111143274 Original CRISPR GTGTTTTGAGCTTTATGTCC AGG Intergenic
No off target data available for this crispr