ID: 1111144401

View in Genome Browser
Species Human (GRCh38)
Location 13:84161545-84161567
Sequence ATGAGTTCATGAGCTTTGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111144401_1111144405 7 Left 1111144401 13:84161545-84161567 CCCTGCAAAGCTCATGAACTCAT No data
Right 1111144405 13:84161575-84161597 TATGGATGCGTAGGATTCCATGG No data
1111144401_1111144404 -2 Left 1111144401 13:84161545-84161567 CCCTGCAAAGCTCATGAACTCAT No data
Right 1111144404 13:84161566-84161588 ATTCTTTTTTATGGATGCGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111144401 Original CRISPR ATGAGTTCATGAGCTTTGCA GGG (reversed) Intergenic
No off target data available for this crispr