ID: 1111144404

View in Genome Browser
Species Human (GRCh38)
Location 13:84161566-84161588
Sequence ATTCTTTTTTATGGATGCGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111144400_1111144404 4 Left 1111144400 13:84161539-84161561 CCATGTCCCTGCAAAGCTCATGA No data
Right 1111144404 13:84161566-84161588 ATTCTTTTTTATGGATGCGTAGG No data
1111144401_1111144404 -2 Left 1111144401 13:84161545-84161567 CCCTGCAAAGCTCATGAACTCAT No data
Right 1111144404 13:84161566-84161588 ATTCTTTTTTATGGATGCGTAGG No data
1111144402_1111144404 -3 Left 1111144402 13:84161546-84161568 CCTGCAAAGCTCATGAACTCATT No data
Right 1111144404 13:84161566-84161588 ATTCTTTTTTATGGATGCGTAGG No data
1111144399_1111144404 14 Left 1111144399 13:84161529-84161551 CCAGCTTCATCCATGTCCCTGCA 0: 5874
1: 13886
2: 10252
3: 14945
4: 8631
Right 1111144404 13:84161566-84161588 ATTCTTTTTTATGGATGCGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111144404 Original CRISPR ATTCTTTTTTATGGATGCGT AGG Intergenic
No off target data available for this crispr