ID: 1111149584

View in Genome Browser
Species Human (GRCh38)
Location 13:84232509-84232531
Sequence ATGTGGGAATGGAGGGAACA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111149576_1111149584 -1 Left 1111149576 13:84232487-84232509 CCCACTGTATGTCTTTTATCACA No data
Right 1111149584 13:84232509-84232531 ATGTGGGAATGGAGGGAACAGGG No data
1111149575_1111149584 3 Left 1111149575 13:84232483-84232505 CCAGCCCACTGTATGTCTTTTAT No data
Right 1111149584 13:84232509-84232531 ATGTGGGAATGGAGGGAACAGGG No data
1111149577_1111149584 -2 Left 1111149577 13:84232488-84232510 CCACTGTATGTCTTTTATCACAT No data
Right 1111149584 13:84232509-84232531 ATGTGGGAATGGAGGGAACAGGG No data
1111149572_1111149584 13 Left 1111149572 13:84232473-84232495 CCCACAGTGCCCAGCCCACTGTA No data
Right 1111149584 13:84232509-84232531 ATGTGGGAATGGAGGGAACAGGG No data
1111149573_1111149584 12 Left 1111149573 13:84232474-84232496 CCACAGTGCCCAGCCCACTGTAT No data
Right 1111149584 13:84232509-84232531 ATGTGGGAATGGAGGGAACAGGG No data
1111149574_1111149584 4 Left 1111149574 13:84232482-84232504 CCCAGCCCACTGTATGTCTTTTA No data
Right 1111149584 13:84232509-84232531 ATGTGGGAATGGAGGGAACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111149584 Original CRISPR ATGTGGGAATGGAGGGAACA GGG Intergenic
No off target data available for this crispr