ID: 1111151614

View in Genome Browser
Species Human (GRCh38)
Location 13:84261192-84261214
Sequence CATTATATTAAGACATTGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111151610_1111151614 9 Left 1111151610 13:84261160-84261182 CCTGTATTGCATCTCTCTTATGG No data
Right 1111151614 13:84261192-84261214 CATTATATTAAGACATTGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111151614 Original CRISPR CATTATATTAAGACATTGGC AGG Intergenic
No off target data available for this crispr