ID: 1111151975

View in Genome Browser
Species Human (GRCh38)
Location 13:84264697-84264719
Sequence GCTCAATGTTATCACATTCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111151975_1111151978 -5 Left 1111151975 13:84264697-84264719 CCTTGAATGTGATAACATTGAGC No data
Right 1111151978 13:84264715-84264737 TGAGCCCTTGGGAGATAATTAGG No data
1111151975_1111151982 18 Left 1111151975 13:84264697-84264719 CCTTGAATGTGATAACATTGAGC No data
Right 1111151982 13:84264738-84264760 CTCAGATTACATCACTGGTGTGG No data
1111151975_1111151981 13 Left 1111151975 13:84264697-84264719 CCTTGAATGTGATAACATTGAGC No data
Right 1111151981 13:84264733-84264755 TTAGGCTCAGATTACATCACTGG No data
1111151975_1111151983 19 Left 1111151975 13:84264697-84264719 CCTTGAATGTGATAACATTGAGC No data
Right 1111151983 13:84264739-84264761 TCAGATTACATCACTGGTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111151975 Original CRISPR GCTCAATGTTATCACATTCA AGG (reversed) Intergenic
No off target data available for this crispr