ID: 1111157815

View in Genome Browser
Species Human (GRCh38)
Location 13:84351416-84351438
Sequence ATCCTGTTCTAGGAGGGACA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111157809_1111157815 1 Left 1111157809 13:84351392-84351414 CCCTGAGCTAAAGCACTGTAGGG No data
Right 1111157815 13:84351416-84351438 ATCCTGTTCTAGGAGGGACAAGG No data
1111157811_1111157815 0 Left 1111157811 13:84351393-84351415 CCTGAGCTAAAGCACTGTAGGGC No data
Right 1111157815 13:84351416-84351438 ATCCTGTTCTAGGAGGGACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111157815 Original CRISPR ATCCTGTTCTAGGAGGGACA AGG Intergenic
No off target data available for this crispr