ID: 1111166688

View in Genome Browser
Species Human (GRCh38)
Location 13:84466732-84466754
Sequence TTTTCTATGTTGAAGGTATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111166688_1111166690 -7 Left 1111166688 13:84466732-84466754 CCAAATACCTTCAACATAGAAAA No data
Right 1111166690 13:84466748-84466770 TAGAAAAAATCAAGAACAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111166688 Original CRISPR TTTTCTATGTTGAAGGTATT TGG (reversed) Intergenic
No off target data available for this crispr