ID: 1111169678

View in Genome Browser
Species Human (GRCh38)
Location 13:84509282-84509304
Sequence TAGCCACAATTGCCACAAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111169678_1111169681 4 Left 1111169678 13:84509282-84509304 CCTTTTTGTGGCAATTGTGGCTA No data
Right 1111169681 13:84509309-84509331 TGCCTTTCCGATTTGGATCCTGG No data
1111169678_1111169680 -3 Left 1111169678 13:84509282-84509304 CCTTTTTGTGGCAATTGTGGCTA No data
Right 1111169680 13:84509302-84509324 CTAGGATTGCCTTTCCGATTTGG No data
1111169678_1111169683 9 Left 1111169678 13:84509282-84509304 CCTTTTTGTGGCAATTGTGGCTA No data
Right 1111169683 13:84509314-84509336 TTCCGATTTGGATCCTGGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111169678 Original CRISPR TAGCCACAATTGCCACAAAA AGG (reversed) Intergenic
No off target data available for this crispr