ID: 1111176033

View in Genome Browser
Species Human (GRCh38)
Location 13:84597485-84597507
Sequence ACCAAAAATGGCCACATACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111176033_1111176036 11 Left 1111176033 13:84597485-84597507 CCCTGTATGTGGCCATTTTTGGT No data
Right 1111176036 13:84597519-84597541 AAACTAATATCTCAGACATCAGG No data
1111176033_1111176039 20 Left 1111176033 13:84597485-84597507 CCCTGTATGTGGCCATTTTTGGT No data
Right 1111176039 13:84597528-84597550 TCTCAGACATCAGGGTCTCTGGG No data
1111176033_1111176037 12 Left 1111176033 13:84597485-84597507 CCCTGTATGTGGCCATTTTTGGT No data
Right 1111176037 13:84597520-84597542 AACTAATATCTCAGACATCAGGG No data
1111176033_1111176038 19 Left 1111176033 13:84597485-84597507 CCCTGTATGTGGCCATTTTTGGT No data
Right 1111176038 13:84597527-84597549 ATCTCAGACATCAGGGTCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111176033 Original CRISPR ACCAAAAATGGCCACATACA GGG (reversed) Intergenic
No off target data available for this crispr