ID: 1111176998

View in Genome Browser
Species Human (GRCh38)
Location 13:84607886-84607908
Sequence GAGGTGAAAGAGTATGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111176991_1111176998 28 Left 1111176991 13:84607835-84607857 CCAACTTATGATATCATCATCTC No data
Right 1111176998 13:84607886-84607908 GAGGTGAAAGAGTATGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111176998 Original CRISPR GAGGTGAAAGAGTATGAGGA AGG Intergenic
No off target data available for this crispr