ID: 1111179599

View in Genome Browser
Species Human (GRCh38)
Location 13:84645781-84645803
Sequence GGGTGGATCAATGCAAATTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111179597_1111179599 -4 Left 1111179597 13:84645762-84645784 CCGTTTCATGCAAATTAAGGGGT No data
Right 1111179599 13:84645781-84645803 GGGTGGATCAATGCAAATTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111179599 Original CRISPR GGGTGGATCAATGCAAATTG AGG Intergenic
No off target data available for this crispr