ID: 1111183089

View in Genome Browser
Species Human (GRCh38)
Location 13:84694229-84694251
Sequence CCATTCCCCCTCACAGAGCG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111183084_1111183089 6 Left 1111183084 13:84694200-84694222 CCAGACTGCTTCTTAGGTGGGAC No data
Right 1111183089 13:84694229-84694251 CCATTCCCCCTCACAGAGCGGGG No data
1111183080_1111183089 16 Left 1111183080 13:84694190-84694212 CCGATTATGGCCAGACTGCTTCT No data
Right 1111183089 13:84694229-84694251 CCATTCCCCCTCACAGAGCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111183089 Original CRISPR CCATTCCCCCTCACAGAGCG GGG Intergenic
No off target data available for this crispr