ID: 1111188110

View in Genome Browser
Species Human (GRCh38)
Location 13:84770335-84770357
Sequence TTTTAATAGCTAAATGAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111188110_1111188111 8 Left 1111188110 13:84770335-84770357 CCATCTTCATTTAGCTATTAAAA No data
Right 1111188111 13:84770366-84770388 CAGAAATAAACTAGACATATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111188110 Original CRISPR TTTTAATAGCTAAATGAAGA TGG (reversed) Intergenic
No off target data available for this crispr