ID: 1111189282

View in Genome Browser
Species Human (GRCh38)
Location 13:84788030-84788052
Sequence TTTCCTTCTCCCAGTTGGTT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111189273_1111189282 28 Left 1111189273 13:84787979-84788001 CCATTATGAGGTGTCTGATTTGG No data
Right 1111189282 13:84788030-84788052 TTTCCTTCTCCCAGTTGGTTCGG No data
1111189271_1111189282 30 Left 1111189271 13:84787977-84787999 CCCCATTATGAGGTGTCTGATTT No data
Right 1111189282 13:84788030-84788052 TTTCCTTCTCCCAGTTGGTTCGG No data
1111189272_1111189282 29 Left 1111189272 13:84787978-84788000 CCCATTATGAGGTGTCTGATTTG No data
Right 1111189282 13:84788030-84788052 TTTCCTTCTCCCAGTTGGTTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111189282 Original CRISPR TTTCCTTCTCCCAGTTGGTT CGG Intergenic
No off target data available for this crispr