ID: 1111189991

View in Genome Browser
Species Human (GRCh38)
Location 13:84794561-84794583
Sequence GTGAAAGATAAATCCATGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111189985_1111189991 24 Left 1111189985 13:84794514-84794536 CCAGATTATCTTGGGACCTCGAG No data
Right 1111189991 13:84794561-84794583 GTGAAAGATAAATCCATGGCTGG No data
1111189988_1111189991 8 Left 1111189988 13:84794530-84794552 CCTCGAGGAGAGGAATTCACAGG No data
Right 1111189991 13:84794561-84794583 GTGAAAGATAAATCCATGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111189991 Original CRISPR GTGAAAGATAAATCCATGGC TGG Intergenic
No off target data available for this crispr