ID: 1111195373

View in Genome Browser
Species Human (GRCh38)
Location 13:84869689-84869711
Sequence CCCAGCAGGTATCCCAAGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111195373_1111195387 21 Left 1111195373 13:84869689-84869711 CCAGACTTGGGATACCTGCTGGG No data
Right 1111195387 13:84869733-84869755 AACATCTGGTGCCCAACGTGGGG No data
1111195373_1111195385 19 Left 1111195373 13:84869689-84869711 CCAGACTTGGGATACCTGCTGGG No data
Right 1111195385 13:84869731-84869753 CCAACATCTGGTGCCCAACGTGG No data
1111195373_1111195381 7 Left 1111195373 13:84869689-84869711 CCAGACTTGGGATACCTGCTGGG No data
Right 1111195381 13:84869719-84869741 GGGCTGGTTTCCCCAACATCTGG No data
1111195373_1111195380 -9 Left 1111195373 13:84869689-84869711 CCAGACTTGGGATACCTGCTGGG No data
Right 1111195380 13:84869703-84869725 CCTGCTGGGTGGTATGGGGCTGG No data
1111195373_1111195386 20 Left 1111195373 13:84869689-84869711 CCAGACTTGGGATACCTGCTGGG No data
Right 1111195386 13:84869732-84869754 CAACATCTGGTGCCCAACGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111195373 Original CRISPR CCCAGCAGGTATCCCAAGTC TGG (reversed) Intergenic
No off target data available for this crispr