ID: 1111197472 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 13:84894126-84894148 |
Sequence | TATGACTTGTAACGCCGCAA AGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1111197472_1111197475 | -7 | Left | 1111197472 | 13:84894126-84894148 | CCTTTGCGGCGTTACAAGTCATA | No data | ||
Right | 1111197475 | 13:84894142-84894164 | AGTCATAAAGGCGGCGCCGATGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1111197472 | Original CRISPR | TATGACTTGTAACGCCGCAA AGG (reversed) | Intergenic | ||