ID: 1111197472 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 13:84894126-84894148 |
| Sequence | TATGACTTGTAACGCCGCAA AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 51 | |||
| Summary | {0: 1, 1: 0, 2: 0, 3: 5, 4: 45} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1111197472_1111197475 | -7 | Left | 1111197472 | 13:84894126-84894148 | CCTTTGCGGCGTTACAAGTCATA | 0: 1 1: 0 2: 0 3: 5 4: 45 |
||
| Right | 1111197475 | 13:84894142-84894164 | AGTCATAAAGGCGGCGCCGATGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1111197472 | Original CRISPR | TATGACTTGTAACGCCGCAA AGG (reversed) | Intergenic | ||