ID: 1111197472

View in Genome Browser
Species Human (GRCh38)
Location 13:84894126-84894148
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111197472_1111197475 -7 Left 1111197472 13:84894126-84894148 CCTTTGCGGCGTTACAAGTCATA No data
Right 1111197475 13:84894142-84894164 AGTCATAAAGGCGGCGCCGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111197472 Original CRISPR TATGACTTGTAACGCCGCAA AGG (reversed) Intergenic