ID: 1111198545

View in Genome Browser
Species Human (GRCh38)
Location 13:84904920-84904942
Sequence GGACACTTCCTAGCCAATAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111198545_1111198550 12 Left 1111198545 13:84904920-84904942 CCTTTATTGGCTAGGAAGTGTCC No data
Right 1111198550 13:84904955-84904977 CTAGCCCTCCTCAAGATCTTGGG No data
1111198545_1111198549 11 Left 1111198545 13:84904920-84904942 CCTTTATTGGCTAGGAAGTGTCC No data
Right 1111198549 13:84904954-84904976 TCTAGCCCTCCTCAAGATCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111198545 Original CRISPR GGACACTTCCTAGCCAATAA AGG (reversed) Intergenic
No off target data available for this crispr