ID: 1111200277

View in Genome Browser
Species Human (GRCh38)
Location 13:84927525-84927547
Sequence GACCCACGCCACCGGGGCCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111200262_1111200277 20 Left 1111200262 13:84927482-84927504 CCCCCGAACTGTGCAACCCACGG No data
Right 1111200277 13:84927525-84927547 GACCCACGCCACCGGGGCCTAGG No data
1111200269_1111200277 4 Left 1111200269 13:84927498-84927520 CCCACGGATTGGAAGGTCCCACT No data
Right 1111200277 13:84927525-84927547 GACCCACGCCACCGGGGCCTAGG No data
1111200266_1111200277 17 Left 1111200266 13:84927485-84927507 CCGAACTGTGCAACCCACGGATT No data
Right 1111200277 13:84927525-84927547 GACCCACGCCACCGGGGCCTAGG No data
1111200264_1111200277 19 Left 1111200264 13:84927483-84927505 CCCCGAACTGTGCAACCCACGGA No data
Right 1111200277 13:84927525-84927547 GACCCACGCCACCGGGGCCTAGG No data
1111200265_1111200277 18 Left 1111200265 13:84927484-84927506 CCCGAACTGTGCAACCCACGGAT No data
Right 1111200277 13:84927525-84927547 GACCCACGCCACCGGGGCCTAGG No data
1111200270_1111200277 3 Left 1111200270 13:84927499-84927521 CCACGGATTGGAAGGTCCCACTC No data
Right 1111200277 13:84927525-84927547 GACCCACGCCACCGGGGCCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111200277 Original CRISPR GACCCACGCCACCGGGGCCT AGG Intergenic
No off target data available for this crispr