ID: 1111202272

View in Genome Browser
Species Human (GRCh38)
Location 13:84954275-84954297
Sequence ATTCAATCCAGAGTCCAGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111202268_1111202272 6 Left 1111202268 13:84954246-84954268 CCTCCTAGCTGCCTCAGTATGAA No data
Right 1111202272 13:84954275-84954297 ATTCAATCCAGAGTCCAGGTAGG No data
1111202267_1111202272 7 Left 1111202267 13:84954245-84954267 CCCTCCTAGCTGCCTCAGTATGA No data
Right 1111202272 13:84954275-84954297 ATTCAATCCAGAGTCCAGGTAGG No data
1111202265_1111202272 12 Left 1111202265 13:84954240-84954262 CCCTTCCCTCCTAGCTGCCTCAG No data
Right 1111202272 13:84954275-84954297 ATTCAATCCAGAGTCCAGGTAGG No data
1111202270_1111202272 -5 Left 1111202270 13:84954257-84954279 CCTCAGTATGAATTAATAATTCA No data
Right 1111202272 13:84954275-84954297 ATTCAATCCAGAGTCCAGGTAGG No data
1111202266_1111202272 11 Left 1111202266 13:84954241-84954263 CCTTCCCTCCTAGCTGCCTCAGT No data
Right 1111202272 13:84954275-84954297 ATTCAATCCAGAGTCCAGGTAGG No data
1111202269_1111202272 3 Left 1111202269 13:84954249-84954271 CCTAGCTGCCTCAGTATGAATTA No data
Right 1111202272 13:84954275-84954297 ATTCAATCCAGAGTCCAGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111202272 Original CRISPR ATTCAATCCAGAGTCCAGGT AGG Intergenic
No off target data available for this crispr