ID: 1111203947

View in Genome Browser
Species Human (GRCh38)
Location 13:84978781-84978803
Sequence GCGTTGTTCACATTTTACCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111203947_1111203949 29 Left 1111203947 13:84978781-84978803 CCCTGGTAAAATGTGAACAACGC No data
Right 1111203949 13:84978833-84978855 TGAATAAAGTCAGAAAACGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111203947 Original CRISPR GCGTTGTTCACATTTTACCA GGG (reversed) Intergenic
No off target data available for this crispr