ID: 1111206970

View in Genome Browser
Species Human (GRCh38)
Location 13:85023242-85023264
Sequence GGAAAGATAATGCACCAAAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111206970_1111206973 11 Left 1111206970 13:85023242-85023264 CCCATTTGGTGCATTATCTTTCC No data
Right 1111206973 13:85023276-85023298 AATGTTTAATATACTTTTAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111206970 Original CRISPR GGAAAGATAATGCACCAAAT GGG (reversed) Intergenic
No off target data available for this crispr