ID: 1111206973

View in Genome Browser
Species Human (GRCh38)
Location 13:85023276-85023298
Sequence AATGTTTAATATACTTTTAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111206970_1111206973 11 Left 1111206970 13:85023242-85023264 CCCATTTGGTGCATTATCTTTCC No data
Right 1111206973 13:85023276-85023298 AATGTTTAATATACTTTTAATGG No data
1111206971_1111206973 10 Left 1111206971 13:85023243-85023265 CCATTTGGTGCATTATCTTTCCA No data
Right 1111206973 13:85023276-85023298 AATGTTTAATATACTTTTAATGG No data
1111206972_1111206973 -10 Left 1111206972 13:85023263-85023285 CCACTCTATTGATAATGTTTAAT No data
Right 1111206973 13:85023276-85023298 AATGTTTAATATACTTTTAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111206973 Original CRISPR AATGTTTAATATACTTTTAA TGG Intergenic
No off target data available for this crispr