ID: 1111213473

View in Genome Browser
Species Human (GRCh38)
Location 13:85111082-85111104
Sequence CCCCTACTTTACCCAAAGTC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111213466_1111213473 24 Left 1111213466 13:85111035-85111057 CCCAATTAATTTATTTTAATATA No data
Right 1111213473 13:85111082-85111104 CCCCTACTTTACCCAAAGTCGGG No data
1111213465_1111213473 28 Left 1111213465 13:85111031-85111053 CCAGCCCAATTAATTTATTTTAA No data
Right 1111213473 13:85111082-85111104 CCCCTACTTTACCCAAAGTCGGG No data
1111213464_1111213473 29 Left 1111213464 13:85111030-85111052 CCCAGCCCAATTAATTTATTTTA No data
Right 1111213473 13:85111082-85111104 CCCCTACTTTACCCAAAGTCGGG No data
1111213467_1111213473 23 Left 1111213467 13:85111036-85111058 CCAATTAATTTATTTTAATATAC No data
Right 1111213473 13:85111082-85111104 CCCCTACTTTACCCAAAGTCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111213473 Original CRISPR CCCCTACTTTACCCAAAGTC GGG Intergenic
No off target data available for this crispr