ID: 1111218462

View in Genome Browser
Species Human (GRCh38)
Location 13:85175369-85175391
Sequence CTGCTGAAGAAGAATGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111218460_1111218462 3 Left 1111218460 13:85175343-85175365 CCAAGATGTCTACTATGTGGTGA No data
Right 1111218462 13:85175369-85175391 CTGCTGAAGAAGAATGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111218462 Original CRISPR CTGCTGAAGAAGAATGAGGA AGG Intergenic
No off target data available for this crispr