ID: 1111218763

View in Genome Browser
Species Human (GRCh38)
Location 13:85178411-85178433
Sequence TGTGCTCTGCAGAGCTACAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111218763_1111218767 4 Left 1111218763 13:85178411-85178433 CCTCTGTAGCTCTGCAGAGCACA No data
Right 1111218767 13:85178438-85178460 CCCTGCCAGCTGCTTTCAATGGG No data
1111218763_1111218771 24 Left 1111218763 13:85178411-85178433 CCTCTGTAGCTCTGCAGAGCACA No data
Right 1111218771 13:85178458-85178480 GGGCTGGTGTTGAGTGTCTATGG No data
1111218763_1111218769 8 Left 1111218763 13:85178411-85178433 CCTCTGTAGCTCTGCAGAGCACA No data
Right 1111218769 13:85178442-85178464 GCCAGCTGCTTTCAATGGGCTGG No data
1111218763_1111218765 3 Left 1111218763 13:85178411-85178433 CCTCTGTAGCTCTGCAGAGCACA No data
Right 1111218765 13:85178437-85178459 TCCCTGCCAGCTGCTTTCAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111218763 Original CRISPR TGTGCTCTGCAGAGCTACAG AGG (reversed) Intergenic
No off target data available for this crispr