ID: 1111221238

View in Genome Browser
Species Human (GRCh38)
Location 13:85207813-85207835
Sequence AAATCATTCAACAAGTCTCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 6117
Summary {0: 29, 1: 513, 2: 2153, 3: 1968, 4: 1454}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111221238_1111221244 24 Left 1111221238 13:85207813-85207835 CCTAGAGACTTGTTGAATGATTT 0: 29
1: 513
2: 2153
3: 1968
4: 1454
Right 1111221244 13:85207860-85207882 GGGCAATGAAGTCCAGGCTGAGG 0: 12
1: 519
2: 1319
3: 1710
4: 1681
1111221238_1111221245 27 Left 1111221238 13:85207813-85207835 CCTAGAGACTTGTTGAATGATTT 0: 29
1: 513
2: 2153
3: 1968
4: 1454
Right 1111221245 13:85207863-85207885 CAATGAAGTCCAGGCTGAGGTGG 0: 490
1: 1361
2: 1982
3: 1478
4: 1076
1111221238_1111221242 4 Left 1111221238 13:85207813-85207835 CCTAGAGACTTGTTGAATGATTT 0: 29
1: 513
2: 2153
3: 1968
4: 1454
Right 1111221242 13:85207840-85207862 CAAAGTGCTGATAGTGATATGGG No data
1111221238_1111221241 3 Left 1111221238 13:85207813-85207835 CCTAGAGACTTGTTGAATGATTT 0: 29
1: 513
2: 2153
3: 1968
4: 1454
Right 1111221241 13:85207839-85207861 CCAAAGTGCTGATAGTGATATGG 0: 16
1: 1015
2: 1697
3: 1542
4: 1042
1111221238_1111221243 18 Left 1111221238 13:85207813-85207835 CCTAGAGACTTGTTGAATGATTT 0: 29
1: 513
2: 2153
3: 1968
4: 1454
Right 1111221243 13:85207854-85207876 TGATATGGGCAATGAAGTCCAGG 0: 17
1: 555
2: 1444
3: 1685
4: 1758

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111221238 Original CRISPR AAATCATTCAACAAGTCTCT AGG (reversed) Intergenic
Too many off-targets to display for this crispr