ID: 1111221242

View in Genome Browser
Species Human (GRCh38)
Location 13:85207840-85207862
Sequence CAAAGTGCTGATAGTGATAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111221238_1111221242 4 Left 1111221238 13:85207813-85207835 CCTAGAGACTTGTTGAATGATTT 0: 29
1: 513
2: 2153
3: 1968
4: 1454
Right 1111221242 13:85207840-85207862 CAAAGTGCTGATAGTGATATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111221242 Original CRISPR CAAAGTGCTGATAGTGATAT GGG Intergenic
No off target data available for this crispr