ID: 1111224809

View in Genome Browser
Species Human (GRCh38)
Location 13:85255403-85255425
Sequence GGGTTCAAACATATGGATTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111224809_1111224812 -5 Left 1111224809 13:85255403-85255425 CCAAAATCCATATGTTTGAACCC No data
Right 1111224812 13:85255421-85255443 AACCCTAATCCCTAAGGTGATGG No data
1111224809_1111224819 17 Left 1111224809 13:85255403-85255425 CCAAAATCCATATGTTTGAACCC No data
Right 1111224819 13:85255443-85255465 GTGTTTGAAGATGGAGGCTTTGG No data
1111224809_1111224820 21 Left 1111224809 13:85255403-85255425 CCAAAATCCATATGTTTGAACCC No data
Right 1111224820 13:85255447-85255469 TTGAAGATGGAGGCTTTGGAAGG No data
1111224809_1111224817 8 Left 1111224809 13:85255403-85255425 CCAAAATCCATATGTTTGAACCC No data
Right 1111224817 13:85255434-85255456 AAGGTGATGGTGTTTGAAGATGG No data
1111224809_1111224818 11 Left 1111224809 13:85255403-85255425 CCAAAATCCATATGTTTGAACCC No data
Right 1111224818 13:85255437-85255459 GTGATGGTGTTTGAAGATGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111224809 Original CRISPR GGGTTCAAACATATGGATTT TGG (reversed) Intergenic
No off target data available for this crispr