ID: 1111227278

View in Genome Browser
Species Human (GRCh38)
Location 13:85290176-85290198
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111227272_1111227278 25 Left 1111227272 13:85290128-85290150 CCTTGAGTCAATGGATACTTTTT No data
Right 1111227278 13:85290176-85290198 TTTCGTTGCTTGGAAAACACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111227278 Original CRISPR TTTCGTTGCTTGGAAAACAC TGG Intergenic
No off target data available for this crispr