ID: 1111230599

View in Genome Browser
Species Human (GRCh38)
Location 13:85340766-85340788
Sequence ACCTCCCTCCCCAGACAGGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111230580_1111230599 27 Left 1111230580 13:85340716-85340738 CCTACCTCCCTGACGGGGCGGCT No data
Right 1111230599 13:85340766-85340788 ACCTCCCTCCCCAGACAGGGCGG No data
1111230577_1111230599 29 Left 1111230577 13:85340714-85340736 CCCCTACCTCCCTGACGGGGCGG No data
Right 1111230599 13:85340766-85340788 ACCTCCCTCCCCAGACAGGGCGG No data
1111230579_1111230599 28 Left 1111230579 13:85340715-85340737 CCCTACCTCCCTGACGGGGCGGC No data
Right 1111230599 13:85340766-85340788 ACCTCCCTCCCCAGACAGGGCGG No data
1111230581_1111230599 23 Left 1111230581 13:85340720-85340742 CCTCCCTGACGGGGCGGCTGCCA No data
Right 1111230599 13:85340766-85340788 ACCTCCCTCCCCAGACAGGGCGG No data
1111230584_1111230599 19 Left 1111230584 13:85340724-85340746 CCTGACGGGGCGGCTGCCAGGCG No data
Right 1111230599 13:85340766-85340788 ACCTCCCTCCCCAGACAGGGCGG No data
1111230583_1111230599 20 Left 1111230583 13:85340723-85340745 CCCTGACGGGGCGGCTGCCAGGC No data
Right 1111230599 13:85340766-85340788 ACCTCCCTCCCCAGACAGGGCGG No data
1111230593_1111230599 3 Left 1111230593 13:85340740-85340762 CCAGGCGGGGGCGGGGGCTGCCC No data
Right 1111230599 13:85340766-85340788 ACCTCCCTCCCCAGACAGGGCGG No data
1111230576_1111230599 30 Left 1111230576 13:85340713-85340735 CCCCCTACCTCCCTGACGGGGCG No data
Right 1111230599 13:85340766-85340788 ACCTCCCTCCCCAGACAGGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111230599 Original CRISPR ACCTCCCTCCCCAGACAGGG CGG Intergenic