ID: 1111237526

View in Genome Browser
Species Human (GRCh38)
Location 13:85429192-85429214
Sequence CCATCCACACAGATGGTACA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111237521_1111237526 -6 Left 1111237521 13:85429175-85429197 CCTTAGTTTAAAATCCTCCATCC No data
Right 1111237526 13:85429192-85429214 CCATCCACACAGATGGTACAGGG No data
1111237520_1111237526 3 Left 1111237520 13:85429166-85429188 CCACACTAACCTTAGTTTAAAAT No data
Right 1111237526 13:85429192-85429214 CCATCCACACAGATGGTACAGGG No data
1111237518_1111237526 16 Left 1111237518 13:85429153-85429175 CCACTTAGCGTACCCACACTAAC No data
Right 1111237526 13:85429192-85429214 CCATCCACACAGATGGTACAGGG No data
1111237519_1111237526 4 Left 1111237519 13:85429165-85429187 CCCACACTAACCTTAGTTTAAAA No data
Right 1111237526 13:85429192-85429214 CCATCCACACAGATGGTACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111237526 Original CRISPR CCATCCACACAGATGGTACA GGG Intergenic
No off target data available for this crispr