ID: 1111251606

View in Genome Browser
Species Human (GRCh38)
Location 13:85608633-85608655
Sequence AAGGGTAAGGAGAAGAGGGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111251606_1111251624 29 Left 1111251606 13:85608633-85608655 CCCGCCCTCTTCTCCTTACCCTT No data
Right 1111251624 13:85608685-85608707 CTCAGGTGTGTAGAACACCATGG No data
1111251606_1111251617 12 Left 1111251606 13:85608633-85608655 CCCGCCCTCTTCTCCTTACCCTT No data
Right 1111251617 13:85608668-85608690 GCCTGCCCCCACATATCCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111251606 Original CRISPR AAGGGTAAGGAGAAGAGGGC GGG (reversed) Intergenic
No off target data available for this crispr