ID: 1111253556

View in Genome Browser
Species Human (GRCh38)
Location 13:85638396-85638418
Sequence AAGGGTGAGCAGGGTGGTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111253545_1111253556 -4 Left 1111253545 13:85638377-85638399 CCTGGCTCCCACGCCTGCCAAGG No data
Right 1111253556 13:85638396-85638418 AAGGGTGAGCAGGGTGGTGAGGG No data
1111253542_1111253556 28 Left 1111253542 13:85638345-85638367 CCTGGCAGGCTGTGCTCAGCTCA 0: 40
1: 74
2: 162
3: 225
4: 581
Right 1111253556 13:85638396-85638418 AAGGGTGAGCAGGGTGGTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111253556 Original CRISPR AAGGGTGAGCAGGGTGGTGA GGG Intergenic
No off target data available for this crispr