ID: 1111256108

View in Genome Browser
Species Human (GRCh38)
Location 13:85670674-85670696
Sequence CTGTGTCCCTGGGAAGAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111256101_1111256108 11 Left 1111256101 13:85670640-85670662 CCCTTATACAACTACAGACACTG No data
Right 1111256108 13:85670674-85670696 CTGTGTCCCTGGGAAGAGGATGG No data
1111256102_1111256108 10 Left 1111256102 13:85670641-85670663 CCTTATACAACTACAGACACTGG No data
Right 1111256108 13:85670674-85670696 CTGTGTCCCTGGGAAGAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111256108 Original CRISPR CTGTGTCCCTGGGAAGAGGA TGG Intergenic
No off target data available for this crispr