ID: 1111263785

View in Genome Browser
Species Human (GRCh38)
Location 13:85779130-85779152
Sequence CTATAAAGATAAAAGGAGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111263785_1111263789 30 Left 1111263785 13:85779130-85779152 CCAACCTCCTTTTATCTTTATAG No data
Right 1111263789 13:85779183-85779205 AGAAAAAACACAAAAGTCAATGG No data
1111263785_1111263788 -8 Left 1111263785 13:85779130-85779152 CCAACCTCCTTTTATCTTTATAG No data
Right 1111263788 13:85779145-85779167 CTTTATAGCACTTTCAATTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111263785 Original CRISPR CTATAAAGATAAAAGGAGGT TGG (reversed) Intergenic
No off target data available for this crispr