ID: 1111263788

View in Genome Browser
Species Human (GRCh38)
Location 13:85779145-85779167
Sequence CTTTATAGCACTTTCAATTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111263785_1111263788 -8 Left 1111263785 13:85779130-85779152 CCAACCTCCTTTTATCTTTATAG No data
Right 1111263788 13:85779145-85779167 CTTTATAGCACTTTCAATTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111263788 Original CRISPR CTTTATAGCACTTTCAATTC TGG Intergenic
No off target data available for this crispr