ID: 1111263789

View in Genome Browser
Species Human (GRCh38)
Location 13:85779183-85779205
Sequence AGAAAAAACACAAAAGTCAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111263785_1111263789 30 Left 1111263785 13:85779130-85779152 CCAACCTCCTTTTATCTTTATAG No data
Right 1111263789 13:85779183-85779205 AGAAAAAACACAAAAGTCAATGG No data
1111263786_1111263789 26 Left 1111263786 13:85779134-85779156 CCTCCTTTTATCTTTATAGCACT No data
Right 1111263789 13:85779183-85779205 AGAAAAAACACAAAAGTCAATGG No data
1111263787_1111263789 23 Left 1111263787 13:85779137-85779159 CCTTTTATCTTTATAGCACTTTC No data
Right 1111263789 13:85779183-85779205 AGAAAAAACACAAAAGTCAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111263789 Original CRISPR AGAAAAAACACAAAAGTCAA TGG Intergenic
No off target data available for this crispr