ID: 1111275522

View in Genome Browser
Species Human (GRCh38)
Location 13:85940506-85940528
Sequence AGCTACCTACTAATGGAACT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111275522_1111275526 25 Left 1111275522 13:85940506-85940528 CCTAGTTCCATTAGTAGGTAGCT No data
Right 1111275526 13:85940554-85940576 GCTCAGCAGAATGCTTCAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111275522 Original CRISPR AGCTACCTACTAATGGAACT AGG (reversed) Intergenic
No off target data available for this crispr