ID: 1111279983

View in Genome Browser
Species Human (GRCh38)
Location 13:86009945-86009967
Sequence AGTCATGTGAAACTACTGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111279983_1111279987 17 Left 1111279983 13:86009945-86009967 CCAGGCAGTAGTTTCACATGACT No data
Right 1111279987 13:86009985-86010007 GAAATAGCTGCATGAGCTAGGGG No data
1111279983_1111279985 15 Left 1111279983 13:86009945-86009967 CCAGGCAGTAGTTTCACATGACT No data
Right 1111279985 13:86009983-86010005 TTGAAATAGCTGCATGAGCTAGG No data
1111279983_1111279986 16 Left 1111279983 13:86009945-86009967 CCAGGCAGTAGTTTCACATGACT No data
Right 1111279986 13:86009984-86010006 TGAAATAGCTGCATGAGCTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111279983 Original CRISPR AGTCATGTGAAACTACTGCC TGG (reversed) Intergenic
No off target data available for this crispr