ID: 1111280933

View in Genome Browser
Species Human (GRCh38)
Location 13:86023923-86023945
Sequence GTATTTTATTTTTTGGCATA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111280931_1111280933 26 Left 1111280931 13:86023874-86023896 CCTGAAACACTTCTGATTCTAAG No data
Right 1111280933 13:86023923-86023945 GTATTTTATTTTTTGGCATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111280933 Original CRISPR GTATTTTATTTTTTGGCATA TGG Intergenic
No off target data available for this crispr