ID: 1111282966

View in Genome Browser
Species Human (GRCh38)
Location 13:86051331-86051353
Sequence CTGGATATAAACTCGGCTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111282962_1111282966 -7 Left 1111282962 13:86051315-86051337 CCTGCTCACCAGCTGCCTGGATA 0: 7
1: 26
2: 92
3: 219
4: 445
Right 1111282966 13:86051331-86051353 CTGGATATAAACTCGGCTGCTGG No data
1111282958_1111282966 -1 Left 1111282958 13:86051309-86051331 CCCAGCCCTGCTCACCAGCTGCC No data
Right 1111282966 13:86051331-86051353 CTGGATATAAACTCGGCTGCTGG No data
1111282959_1111282966 -2 Left 1111282959 13:86051310-86051332 CCAGCCCTGCTCACCAGCTGCCT No data
Right 1111282966 13:86051331-86051353 CTGGATATAAACTCGGCTGCTGG No data
1111282961_1111282966 -6 Left 1111282961 13:86051314-86051336 CCCTGCTCACCAGCTGCCTGGAT 0: 6
1: 33
2: 94
3: 202
4: 506
Right 1111282966 13:86051331-86051353 CTGGATATAAACTCGGCTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111282966 Original CRISPR CTGGATATAAACTCGGCTGC TGG Intergenic
No off target data available for this crispr