ID: 1111287157

View in Genome Browser
Species Human (GRCh38)
Location 13:86109865-86109887
Sequence AGCCATTACCATAGGAAGCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111287157_1111287166 29 Left 1111287157 13:86109865-86109887 CCTAGCTTCCTATGGTAATGGCT No data
Right 1111287166 13:86109917-86109939 GCTTCTGCGGAGCCTGTATCTGG No data
1111287157_1111287161 -4 Left 1111287157 13:86109865-86109887 CCTAGCTTCCTATGGTAATGGCT No data
Right 1111287161 13:86109884-86109906 GGCTATGGTGTCTGAAATGTGGG No data
1111287157_1111287160 -5 Left 1111287157 13:86109865-86109887 CCTAGCTTCCTATGGTAATGGCT No data
Right 1111287160 13:86109883-86109905 TGGCTATGGTGTCTGAAATGTGG No data
1111287157_1111287167 30 Left 1111287157 13:86109865-86109887 CCTAGCTTCCTATGGTAATGGCT No data
Right 1111287167 13:86109918-86109940 CTTCTGCGGAGCCTGTATCTGGG No data
1111287157_1111287163 16 Left 1111287157 13:86109865-86109887 CCTAGCTTCCTATGGTAATGGCT No data
Right 1111287163 13:86109904-86109926 GGGCAGGCCCAGTGCTTCTGCGG No data
1111287157_1111287162 0 Left 1111287157 13:86109865-86109887 CCTAGCTTCCTATGGTAATGGCT No data
Right 1111287162 13:86109888-86109910 ATGGTGTCTGAAATGTGGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111287157 Original CRISPR AGCCATTACCATAGGAAGCT AGG (reversed) Intergenic
No off target data available for this crispr