ID: 1111290023

View in Genome Browser
Species Human (GRCh38)
Location 13:86154690-86154712
Sequence GTGAACAATCAGTGGAGTAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111290023_1111290025 7 Left 1111290023 13:86154690-86154712 CCAATACTCCACTGATTGTTCAC No data
Right 1111290025 13:86154720-86154742 AATTCGCATAATAGTTCTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111290023 Original CRISPR GTGAACAATCAGTGGAGTAT TGG (reversed) Intergenic
No off target data available for this crispr