ID: 1111291516

View in Genome Browser
Species Human (GRCh38)
Location 13:86177206-86177228
Sequence TCACAGATACTGAAGGAAGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111291516_1111291518 -8 Left 1111291516 13:86177206-86177228 CCGTCTTCCTTCAGTATCTGTGA No data
Right 1111291518 13:86177221-86177243 ATCTGTGAAGAATTTTTTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111291516 Original CRISPR TCACAGATACTGAAGGAAGA CGG (reversed) Intergenic
No off target data available for this crispr