ID: 1111291731

View in Genome Browser
Species Human (GRCh38)
Location 13:86180036-86180058
Sequence CAGTAGGGTAAGATGTGGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111291723_1111291731 9 Left 1111291723 13:86180004-86180026 CCTCATGTGTGTTATGGCTCTTG No data
Right 1111291731 13:86180036-86180058 CAGTAGGGTAAGATGTGGAGGGG No data
1111291722_1111291731 10 Left 1111291722 13:86180003-86180025 CCCTCATGTGTGTTATGGCTCTT No data
Right 1111291731 13:86180036-86180058 CAGTAGGGTAAGATGTGGAGGGG No data
1111291720_1111291731 25 Left 1111291720 13:86179988-86180010 CCATAGGAGATGTCACCCTCATG No data
Right 1111291731 13:86180036-86180058 CAGTAGGGTAAGATGTGGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111291731 Original CRISPR CAGTAGGGTAAGATGTGGAG GGG Intergenic
No off target data available for this crispr