ID: 1111292539

View in Genome Browser
Species Human (GRCh38)
Location 13:86187219-86187241
Sequence CAGTACTTACAGCAAATTAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111292533_1111292539 -10 Left 1111292533 13:86187206-86187228 CCCCTTCTCCCTACAGTACTTAC No data
Right 1111292539 13:86187219-86187241 CAGTACTTACAGCAAATTAAGGG No data
1111292527_1111292539 21 Left 1111292527 13:86187175-86187197 CCAGTGAATTTTGGCCCAGTAAG No data
Right 1111292539 13:86187219-86187241 CAGTACTTACAGCAAATTAAGGG No data
1111292532_1111292539 -4 Left 1111292532 13:86187200-86187222 CCAGGTCCCCTTCTCCCTACAGT No data
Right 1111292539 13:86187219-86187241 CAGTACTTACAGCAAATTAAGGG No data
1111292530_1111292539 7 Left 1111292530 13:86187189-86187211 CCCAGTAAGGTCCAGGTCCCCTT No data
Right 1111292539 13:86187219-86187241 CAGTACTTACAGCAAATTAAGGG No data
1111292531_1111292539 6 Left 1111292531 13:86187190-86187212 CCAGTAAGGTCCAGGTCCCCTTC No data
Right 1111292539 13:86187219-86187241 CAGTACTTACAGCAAATTAAGGG No data
1111292526_1111292539 22 Left 1111292526 13:86187174-86187196 CCCAGTGAATTTTGGCCCAGTAA No data
Right 1111292539 13:86187219-86187241 CAGTACTTACAGCAAATTAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111292539 Original CRISPR CAGTACTTACAGCAAATTAA GGG Intergenic
No off target data available for this crispr