ID: 1111300973 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 13:86349915-86349937 |
| Sequence | ACTACAGGGTTCACTCTGAC TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1111300968_1111300973 | 25 | Left | 1111300968 | 13:86349867-86349889 | CCATTTAAACATATGAAAATATA | No data | ||
| Right | 1111300973 | 13:86349915-86349937 | ACTACAGGGTTCACTCTGACTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1111300973 | Original CRISPR | ACTACAGGGTTCACTCTGAC TGG | Intergenic | ||