ID: 1111300973

View in Genome Browser
Species Human (GRCh38)
Location 13:86349915-86349937
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111300968_1111300973 25 Left 1111300968 13:86349867-86349889 CCATTTAAACATATGAAAATATA No data
Right 1111300973 13:86349915-86349937 ACTACAGGGTTCACTCTGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111300973 Original CRISPR ACTACAGGGTTCACTCTGAC TGG Intergenic