ID: 1111302782

View in Genome Browser
Species Human (GRCh38)
Location 13:86366773-86366795
Sequence TAAAAGCAGGCAGAGGAATG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1855
Summary {0: 33, 1: 135, 2: 250, 3: 415, 4: 1022}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1111302782_1111302785 -9 Left 1111302782 13:86366773-86366795 CCACATTCCTCTGCCTGCTTTTA 0: 33
1: 135
2: 250
3: 415
4: 1022
Right 1111302785 13:86366787-86366809 CTGCTTTTATCTTGCCATGTTGG No data
1111302782_1111302789 25 Left 1111302782 13:86366773-86366795 CCACATTCCTCTGCCTGCTTTTA 0: 33
1: 135
2: 250
3: 415
4: 1022
Right 1111302789 13:86366821-86366843 ATGGTATCCATCCAGATTGAGGG No data
1111302782_1111302788 24 Left 1111302782 13:86366773-86366795 CCACATTCCTCTGCCTGCTTTTA 0: 33
1: 135
2: 250
3: 415
4: 1022
Right 1111302788 13:86366820-86366842 GATGGTATCCATCCAGATTGAGG No data
1111302782_1111302787 6 Left 1111302782 13:86366773-86366795 CCACATTCCTCTGCCTGCTTTTA 0: 33
1: 135
2: 250
3: 415
4: 1022
Right 1111302787 13:86366802-86366824 CATGTTGGCAGCTGATTAGATGG 0: 12
1: 227
2: 380
3: 665
4: 730
1111302782_1111302790 28 Left 1111302782 13:86366773-86366795 CCACATTCCTCTGCCTGCTTTTA 0: 33
1: 135
2: 250
3: 415
4: 1022
Right 1111302790 13:86366824-86366846 GTATCCATCCAGATTGAGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1111302782 Original CRISPR TAAAAGCAGGCAGAGGAATG TGG (reversed) Intergenic
900172303 1:1274917-1274939 TGAGAGGAGGCAGAGGAAGGAGG - Intergenic
900536857 1:3182934-3182956 TAAAAGCAAGGAGGGGAGTGGGG - Intronic
900719821 1:4168294-4168316 TAAAAGCAGGCAGAAGAATGTGG - Intergenic
900721590 1:4179582-4179604 GAAAAGCAGGCAGAAGAACATGG - Intergenic
900724938 1:4209971-4209993 ATAAAGCAGGCAGAAGAATGTGG - Intergenic
900730116 1:4252683-4252705 TAAAAGCAGGCAGGAGAACATGG + Intergenic
900853203 1:5159963-5159985 ATAAAGCAGGCAGAAGAAAGTGG - Intergenic
900896466 1:5486327-5486349 GAGGAGCAGGCAGAGGAACGGGG + Intergenic
901374012 1:8824580-8824602 TAAAGGGAGGCAGAGGCAGGAGG + Intergenic
901418877 1:9136872-9136894 TAAAAGCAAGCAGAAGAACATGG - Intergenic
901483943 1:9545158-9545180 TGAGAGAAGGTAGAGGAATGGGG + Intronic
901484026 1:9545714-9545736 TAAAAGGAGGCCGAGGCAGGTGG + Intronic
901781670 1:11598538-11598560 TCAAATGAGGCAAAGGAATGAGG + Intergenic
901791887 1:11658173-11658195 AAGATGCAGGCAGAGGAGTGGGG + Intronic
901833883 1:11911121-11911143 AAAAAGCAGGCAGAAGAAGGTGG - Intergenic
901920471 1:12532701-12532723 TAAAAGCAGGCAGAGGAACGTGG - Intergenic
902179654 1:14678239-14678261 AAAAAGCAGGCAGAAGAAGGTGG + Intronic
902195465 1:14794887-14794909 TAAAAGCAGGCAGAGGAACATGG + Intronic
902778569 1:18690289-18690311 AAAAAGGAGGAAGAGGAGTGGGG + Intronic
903149519 1:21396285-21396307 TATAAGAAGACATAGGAATGTGG + Intergenic
903814961 1:26058207-26058229 TAAAATCAGTAAGAGGAAGGTGG + Intronic
904059054 1:27693370-27693392 TATAAGAAGGCATGGGAATGTGG - Intergenic
904580336 1:31538675-31538697 TGAAATCAGGCAGGGGAGTGGGG - Intergenic
905262273 1:36728263-36728285 TAAAAGCAGGTAGAAGAATGTGG + Intergenic
905536126 1:38723252-38723274 TAAAAGCGGGCAGAGGAATGTGG - Intergenic
905697657 1:39987223-39987245 TAAAAGGGAGCAGAGAAATGGGG + Intergenic
905866631 1:41380463-41380485 CAAAAGCAGGCAGTGACATGGGG + Intronic
905931836 1:41793368-41793390 AAGAAGCAGGCAGAAGAGTGAGG - Intronic
906302761 1:44695544-44695566 TAAAGGGAGGCAGAGGCAGGAGG + Intronic
906346658 1:45019727-45019749 TACAAGCATGCACAGGGATGGGG + Intronic
906865001 1:49408581-49408603 TAAAAGCAGGCAGAGGAACATGG + Intronic
907082390 1:51635821-51635843 AAATTGCAGGCAGAGGATTGTGG - Intronic
907571927 1:55491714-55491736 ATAAAGCAGGCAGAAGAACGTGG - Intergenic
907669106 1:56459079-56459101 ATAAAGCAGGCAGAAGAATGTGG + Intergenic
908038999 1:60087047-60087069 TAAAAGCAGACAGAAGAACATGG + Intergenic
908326353 1:63027668-63027690 TAAAAGCAGGCAGAGGAATGTGG + Intergenic
908391870 1:63690638-63690660 TAAAAGCAGGCAAAAGAACATGG - Intergenic
908397410 1:63739116-63739138 ATAAAGCAGGCAGAAGAAAGTGG - Intergenic
908789592 1:67768469-67768491 AAAAAACAGGCTGAGGAATGGGG + Intronic
908830458 1:68173628-68173650 AAAGAGCTGGCAGAGGGATGGGG + Intronic
909032568 1:70559735-70559757 ATAAAGCAGGCAGAAGAAAGTGG - Intergenic
909176712 1:72370879-72370901 TAAAAGCAGGCAGAGGAATGTGG + Intergenic
909215235 1:72878314-72878336 AAAAAGCAGGTAGAAGAAGGTGG + Intergenic
909858605 1:80574483-80574505 TAAAAGCAGGCAGAGGAACATGG - Intergenic
910070363 1:83206568-83206590 GAAAAACAAGCAGAGGACTGTGG - Intergenic
910535436 1:88292355-88292377 TCCAAGCAGGCAGAAAAATGAGG + Intergenic
910791486 1:91055586-91055608 TAAAAGCAGGCAGAAGAACGTGG - Intergenic
910796445 1:91102336-91102358 TAAAAGCAGGCAGAAGAACATGG - Intergenic
911231627 1:95367940-95367962 TAAAGGCAGCCAGAGGAACCTGG + Intergenic
911263064 1:95710258-95710280 TAAAAGCAGGCAGAGGAACATGG - Intergenic
911307386 1:96247494-96247516 TAAAAGCAGGCAGAGGAACATGG + Intergenic
911343462 1:96668483-96668505 TAAAAACAGGCAGAAGAACATGG + Intergenic
911403678 1:97408779-97408801 ATAAAGCAGGCAGAAGAAGGTGG + Intronic
911642977 1:100308444-100308466 ATAAAGCAGGCAGAGGAAGTTGG - Intergenic
911684057 1:100753542-100753564 CAAAAGAAGGCAGAGAAAAGAGG - Intergenic
911761751 1:101625290-101625312 TAAAAGTAGGCAGAAAAATGTGG + Intergenic
912119798 1:106456079-106456101 TAAAAGCAGGCAGAAGAACATGG - Intergenic
912703368 1:111894903-111894925 GAAGAGCAGGAAGAGGAAAGAGG + Intronic
912706112 1:111914521-111914543 TAAAAGCAGCCAGTGGAAAAAGG + Intronic
913116223 1:115699896-115699918 AAAGAGCAGGCAGAGGAAGAGGG + Intergenic
913477749 1:119255090-119255112 ATAAAGCAGGCAGAGGAATGTGG + Intergenic
913614773 1:120547314-120547336 TAAAACCAGGCAGAAAAGTGGGG - Intergenic
914575498 1:148963593-148963615 TAAAACCAGGCAGAAAAGTGGGG + Intronic
914957231 1:152173694-152173716 TAAAAGCAGTGAGTTGAATGGGG - Intergenic
915557128 1:156667084-156667106 TCAATGCAGCAAGAGGAATGAGG - Intergenic
915793190 1:158697648-158697670 TAAAAGCTAGCAGAAGAACGTGG - Intergenic
916035617 1:160920072-160920094 TATAAGAAGGCAAGGGAATGTGG - Intergenic
916688799 1:167171628-167171650 CACAAGCAGGCAGAAGAAGGGGG - Intergenic
916766445 1:167865194-167865216 TAGAAGGAGGCATAAGAATGTGG + Intronic
916919567 1:169449742-169449764 TAAAAGCAGGCAGAAGAAGGTGG - Intronic
917218849 1:172706123-172706145 TAAAAGCAGGCTCAGAAATCTGG - Intergenic
917542351 1:175926639-175926661 TAAAAGCAGGCAGAAGAACGTGG - Intergenic
917705639 1:177631475-177631497 TAAAAGAAGGAAGAGGAAACAGG + Intergenic
917791112 1:178499481-178499503 TAAAAGCAGGCAGAAGAACACGG + Intergenic
918217872 1:182408814-182408836 TAAAGGAAGGCACAGGAAGGAGG + Intergenic
918348662 1:183631078-183631100 TAGAAGCAGGGAGAGCAATTAGG + Intronic
918550779 1:185739812-185739834 AAAAAGCAGGAAAAGGGATGGGG + Intronic
918706536 1:187669485-187669507 ATAAAGCAGGCAGAAGAAAGTGG - Intergenic
918776301 1:188635936-188635958 TAAAAGCAGGCAGAGGTACGTGG - Intergenic
918815407 1:189174114-189174136 TAAAAGCAGACAGAGGAATGTGG + Intergenic
918847520 1:189637472-189637494 AAAAAGCAGACAGAAGAACGTGG + Intergenic
918887234 1:190210866-190210888 ATAAAGCAGGCAGAAGAATGCGG + Intronic
918895447 1:190337477-190337499 TAAAAGCAGGCAGAGGAACATGG + Intronic
918911822 1:190582714-190582736 TAAAAGCAGGAAGAAGAACATGG - Intergenic
919005156 1:191889556-191889578 TAAAAGCAGCCAGAGGAAAGAGG - Intergenic
919125111 1:193383744-193383766 GAAAAGCAGGCAGAAGAAGCTGG - Intergenic
919125508 1:193388297-193388319 GAAAAGCAGGCAGAAGAAGCTGG - Intergenic
919160389 1:193822321-193822343 GGAAAGCAGGCAGAAGAATGAGG + Intergenic
919268363 1:195304234-195304256 TAAAAGCAGGCAGAAAAACCTGG + Intergenic
919316853 1:195981685-195981707 ATAAAGCAGGCAGAAGAAAGTGG + Intergenic
919741331 1:200983213-200983235 CAGAGACAGGCAGAGGAATGAGG + Intronic
920111640 1:203591362-203591384 CAAAAGCAGAGAGAGGAATTGGG + Intergenic
920219449 1:204385918-204385940 AAAATGCAGGAAGTGGAATGAGG - Intergenic
920381753 1:205538742-205538764 TCAGAGAAGCCAGAGGAATGTGG + Intergenic
920826616 1:209428980-209429002 AAAAAGTAAGCAGAGGAAAGTGG - Intergenic
920998633 1:211019070-211019092 CAAAACCAGGCAGAATAATGTGG - Exonic
921451934 1:215318892-215318914 TAAAAACAGGCAGAGGAACCTGG - Intergenic
921544020 1:216452877-216452899 TAAAAGCAGGCAGAAGCACATGG + Intergenic
921810177 1:219503434-219503456 TGGCAGCAGGCAGAGGCATGAGG + Intergenic
921927146 1:220720496-220720518 TATAAGGAGGCATAAGAATGTGG + Intergenic
921940049 1:220829850-220829872 TAAAAGCACACAGAGGAACATGG - Intergenic
921978278 1:221226962-221226984 TAAAAGCAGGCAGAAGAACGTGG + Intergenic
922019062 1:221685506-221685528 AAAAGGCAGGCAGAAGAAGGTGG - Intergenic
922043270 1:221918030-221918052 TAAAAGCAGGCAGAAGAACGTGG + Intergenic
922156916 1:223047765-223047787 ACAAAGCAGGCAGAAGAAGGTGG - Intergenic
922225804 1:223645232-223645254 TAAAAGCAGGCTGAGGAATATGG - Intronic
922365564 1:224860339-224860361 TAAAAGCAGGCAAAAGAATCTGG - Intergenic
922388063 1:225108101-225108123 TAAAAACTGGCAGAGGAACGTGG + Intronic
922494581 1:226046641-226046663 ACAAAGCAGACAGAGGAAGGTGG - Intergenic
922651407 1:227342212-227342234 ATAAAGCAGGCAGAAGAAGGTGG - Intergenic
922767310 1:228162801-228162823 TATCAGCAGGCAGGGGACTGGGG - Intergenic
923082942 1:230676897-230676919 TAAAAGCAGCCAGAGAAAAAAGG - Intronic
923118763 1:230970355-230970377 TAAAAGGAGGCAGAGGGATGGGG + Intronic
923167908 1:231384756-231384778 TAAAAACAGGCAGTGGGCTGTGG - Intronic
923416972 1:233772328-233772350 TAAAAGCAGGCAGATGAATGTGG - Intergenic
923647624 1:235840059-235840081 AATAAGCAGGAAGAGGAATATGG - Intronic
923864454 1:237924303-237924325 TAAAAGCAGGCAGAAGAAAGTGG - Intergenic
923946997 1:238899222-238899244 TGAAAGCAGGCAGAGGAACAAGG - Intergenic
924735435 1:246751479-246751501 TATAAGGAGGCATAAGAATGTGG - Intronic
924919559 1:248613389-248613411 TAAAGGCAGCTAGAGAAATGGGG + Intergenic
924934528 1:248756809-248756831 TAAAAGCAGGCAGCAGAACGAGG - Intergenic
1062770935 10:100207-100229 TAAAAGCAGGGAGAAGAACATGG - Intergenic
1063039765 10:2325221-2325243 TAAAAGCAGGCAGAGGAAGGTGG + Intergenic
1063149248 10:3321778-3321800 TAAAAGCAGGCAGAGGAATGTGG + Intergenic
1063175298 10:3545196-3545218 ATAAAGCAGGCAGAGGAACATGG - Intergenic
1063303979 10:4879522-4879544 CAAAAGCAGGCAGAGAAAAATGG - Intergenic
1063369723 10:5513247-5513269 TTAAAGCAGGCAAAGGGATTCGG - Intergenic
1063457806 10:6196639-6196661 CAAAAGCAGGCAGAAGACCGTGG - Intronic
1063525368 10:6779601-6779623 ATAAAGCAGGCAGAGGAACGTGG + Intergenic
1064177885 10:13091095-13091117 AAAAAGCAGGCAGAAGAAGGTGG - Intronic
1064320916 10:14303694-14303716 TAAAAGGAGGTAGAGGAGTTAGG + Intronic
1064325805 10:14350163-14350185 TAAAAGCAGACAGAGGAATGTGG - Intronic
1064329076 10:14376906-14376928 TAAAAGCGGACAGAGGAACGTGG + Intronic
1064360856 10:14662977-14662999 TAAAAGCAGGAAGAAGAAAGAGG + Intronic
1064362648 10:14679830-14679852 TAAAAGCAGGCAGAGGAACGAGG + Intronic
1064519783 10:16188906-16188928 TAAAAACAGGCAGAAGAATGAGG + Intergenic
1064680007 10:17801253-17801275 TAAAAGCAGGCAGAGGAACGTGG - Intergenic
1064854856 10:19754620-19754642 ATAAAGCAGGCAGAAGAAAGTGG + Intronic
1065155851 10:22869481-22869503 ATAAAGCAGGCAGAAGAATATGG + Intergenic
1065173771 10:23057278-23057300 TAAAAGCAGGCAGAGGAGCGTGG - Intergenic
1065202243 10:23324349-23324371 TAACAGCAGGGAGAAGAAAGAGG - Intronic
1065387403 10:25147329-25147351 GAAAAGCAGGCAGAGGAACCTGG - Intergenic
1065417519 10:25504356-25504378 TAAAAGCAAGTTAAGGAATGGGG - Intronic
1065476761 10:26146588-26146610 TAAGAGCAGGAAGAGGAACCAGG - Intronic
1065525156 10:26612722-26612744 TAACAGCAGGCAGAAGAATGTGG + Intergenic
1065739109 10:28780948-28780970 TAAAAGCAGACAGAAGAACGTGG - Intergenic
1065762906 10:28999616-28999638 TAAAAGTGGGCAGAAGAACGTGG - Intergenic
1065802416 10:29364907-29364929 TATAAGGAGGCATAAGAATGTGG - Intergenic
1065867999 10:29930298-29930320 TAAAAGCAGACAGAAGAACTTGG - Intergenic
1066514574 10:36143176-36143198 AGAAAGAATGCAGAGGAATGAGG - Intergenic
1067326943 10:45278259-45278281 TATAAGGAGGCATAAGAATGTGG - Intergenic
1067330542 10:45312336-45312358 TAAAAACAGGCAGAGTAAAAAGG + Intronic
1067699239 10:48556801-48556823 TAAATGCAGACACAGGGATGCGG - Intronic
1067822916 10:49546397-49546419 TATAAGAAGGCATGGGAATGTGG - Intergenic
1068504127 10:57877732-57877754 TAAAAGCAGGGAGAGGAACATGG + Intergenic
1068548269 10:58377183-58377205 TAAAAGCAGTCAGAGAAAATAGG - Intergenic
1068648876 10:59499700-59499722 ACAAAGCAGGCAGAAGAAGGTGG + Intergenic
1068661816 10:59630324-59630346 CAAAACCAGGCTGAGCAATGTGG + Intergenic
1068811008 10:61256310-61256332 TAAAAGTGGGCAGAGGAATGTGG + Intergenic
1068834199 10:61534301-61534323 TAAAAGCAGGAAGAGGAAGGTGG - Intergenic
1069096302 10:64263679-64263701 AAAAAGCAGGCAGAAGAACAAGG - Intergenic
1069114889 10:64492629-64492651 CAGAGGCAGGCAGAGGAAGGAGG - Intergenic
1069119931 10:64556920-64556942 TAAAAGCAGGCAGAGGAACATGG + Intergenic
1069168877 10:65200073-65200095 TAAAAGCAGGCAGAGGAACGTGG + Intergenic
1069786362 10:70990711-70990733 GAAAGGCAGACAGAGGATTGGGG + Intergenic
1069788219 10:71003383-71003405 TAAAAGCAGGTAGAAGAACGTGG - Intergenic
1070315804 10:75311239-75311261 TAAAAGCAGGCAGAAGAATGTGG - Intergenic
1070955888 10:80463192-80463214 TAGAACAAGGCAGAGTAATGGGG - Intronic
1070976406 10:80609301-80609323 TAAAAGGAGGAGGAGGAAGGGGG - Intronic
1071283223 10:84121888-84121910 TATAAGGAGGCATAAGAATGTGG - Intergenic
1071288419 10:84170463-84170485 TATAAGGAGGCATAAGAATGTGG - Intergenic
1071364150 10:84881980-84882002 TAAAAGCAGACAGAGGAACACGG - Intergenic
1071374309 10:84987005-84987027 CAAAAGCAGGCAGAGGAACATGG - Intergenic
1071673611 10:87634880-87634902 ACAAAGCAGGCAGAAGAAGGTGG - Intergenic
1071674385 10:87641025-87641047 ACAAAGCAGGCAGAAGAATATGG - Intergenic
1071713235 10:88070380-88070402 TAAAAGCAGGGAGATGGATAGGG - Intergenic
1071932778 10:90491918-90491940 TAAAGGCAGCTAGAGGAAAGTGG + Intergenic
1071944864 10:90632973-90632995 TAAAAGCAGGCAGTGGAACGTGG - Intergenic
1072752161 10:97989009-97989031 GAAAAACACGCAGAGGAAGGAGG + Intronic
1073178133 10:101569019-101569041 TACAAGCAGGCACAGAAATGAGG + Intergenic
1073327495 10:102651098-102651120 TGAGAGCAGGAAGAGGAAGGAGG - Intronic
1073580780 10:104663817-104663839 TAAAAGAAGAAAGAGGAGTGGGG - Intronic
1073806633 10:107105663-107105685 TAAAAGCAGGCAGAGGAATATGG - Intronic
1073878010 10:107948129-107948151 TATAAACAGGCAGAAAAATGTGG - Intergenic
1073891632 10:108109476-108109498 GAAAAGCAAGAAGAGGAACGAGG + Intergenic
1074034045 10:109720074-109720096 TAAAAGCAGGCAGAGGAACCTGG + Intergenic
1074346595 10:112692330-112692352 AAAGAGCAGACAGAAGAATGAGG - Intronic
1074464118 10:113666841-113666863 TAAAAAAAGCCAGAGCAATGTGG - Intergenic
1074602693 10:114931350-114931372 AAAAAGCAGGCAGAAGAAGGTGG + Intergenic
1074878069 10:117629982-117630004 TGCCAGCAGGCAGAGGAATGTGG - Intergenic
1075000415 10:118792859-118792881 CAAAGGCAGGCAGGGGAATGGGG - Intergenic
1075071854 10:119325174-119325196 TAAAAGTAGGCACAGAACTGGGG - Intronic
1075217154 10:120545909-120545931 ATAAAGCAGGCAGATGAACGTGG + Intronic
1075257203 10:120934726-120934748 ACAAAGCAGGCAGAGGGAGGGGG - Intergenic
1075418696 10:122285075-122285097 TAATAGCAGGAAGAAGAATCAGG + Intronic
1075494419 10:122907504-122907526 TAAAAGCAGGCAGAGGAACTTGG + Intergenic
1075520229 10:123139050-123139072 AAAAAGTAGGCAGGGGAAAGGGG + Intergenic
1075573981 10:123565215-123565237 TAAAAGCAGGCAGAAGAATGTGG - Intergenic
1075585943 10:123658337-123658359 TAAAAGCAGGCAGAGGAACATGG - Intergenic
1075913929 10:126149615-126149637 ATAAAGTAGGCAGAGGAATGTGG + Intronic
1075935469 10:126337362-126337384 TCAAAGCAGGAAGAGGAAGGTGG - Intronic
1076081634 10:127586886-127586908 GAAAAACTGGTAGAGGAATGGGG - Intergenic
1076083156 10:127601638-127601660 AAAGAGGAGGCAGAGGACTGAGG - Intergenic
1076276164 10:129200516-129200538 ATAAAGCAGGCAGAAGAATGTGG - Intergenic
1076302036 10:129435826-129435848 TAAAAGCAAGCAGAAGAACGTGG - Intergenic
1076501403 10:130939249-130939271 TAAAAGCAGGCAGAGGAACGTGG - Intergenic
1076718488 10:132381174-132381196 AAAAAGCAGGCAGAAGAAGGTGG + Intergenic
1076783171 10:132735638-132735660 TGTGAGCAGGCAGAGGAACGCGG - Intronic
1077873841 11:6285985-6286007 TATAAGAAGGCATAGGAATGTGG + Intergenic
1078061004 11:8043983-8044005 TAAGAGCAGCCAGAAGAAGGGGG - Intronic
1078082280 11:8212826-8212848 TAAAAACAGGTTGAGAAATGAGG - Intergenic
1078582025 11:12546162-12546184 ACAAAGCAGGCAGAAGAAGGTGG + Intergenic
1078751409 11:14167994-14168016 TATAAGAAGGCATAGGAATATGG - Intronic
1078970842 11:16409298-16409320 AAAAAACAGGCAGAGGATTGGGG + Intronic
1078974714 11:16460055-16460077 AAAAAGCAGCCAGAGGAAAATGG + Intronic
1079182799 11:18208727-18208749 TAAAAGCAGGCAGACGAACATGG + Intronic
1079210195 11:18454504-18454526 TAAAAGCAGGCAGAGGAACGTGG - Intergenic
1079210826 11:18459243-18459265 TAAAAGCAGGCAGAGGAACGTGG + Intronic
1079235407 11:18685253-18685275 TATAAGAAGGCATGGGAATGTGG - Intergenic
1079365294 11:19803731-19803753 CAAAAGCAGGGAGAAGAATGAGG - Intronic
1079506466 11:21158048-21158070 TAAAAGCAGGCAGAGGAACGTGG + Intronic
1079537137 11:21527855-21527877 TAAAAGCAGGCAGAGGAACGTGG - Intronic
1079607866 11:22392253-22392275 AAAAAGCAGGCAGAAGAACCTGG + Intergenic
1079623812 11:22591040-22591062 ATAAAGCAGGCAGAAGAAAGTGG - Intergenic
1079762062 11:24341335-24341357 ATAAAGCAGGCAGAAGAACGTGG - Intergenic
1080098918 11:28436957-28436979 ATAAAGCAGGCAGAAGAAGGCGG + Intergenic
1080146361 11:28989244-28989266 TAAAAGCAGGAAGAGAAACTTGG + Intergenic
1080407992 11:31997005-31997027 TAAAAGCAGGCAGGAGAACGTGG - Intronic
1080417304 11:32080825-32080847 TAAAAGCAGGCAGAAGAACATGG + Intronic
1080959495 11:37141760-37141782 TAAAAGCAGGCAGGGGAACATGG + Intergenic
1081062581 11:38498980-38499002 TGAAAGCAGGCAGAAGAACGTGG + Intergenic
1081077059 11:38690472-38690494 CAGAAGCAGGCAGAAGAAAGTGG + Intergenic
1081247183 11:40782130-40782152 GAAAAGCTGACAGAGGAAAGAGG - Intronic
1081439202 11:43061875-43061897 TAAAAGCAGGCAGAAGAGCATGG - Intergenic
1081762560 11:45586569-45586591 TCAAAGAAGGCAGAGGAGAGGGG + Intergenic
1081869445 11:46376669-46376691 TAAAAGCTCTCAGAGGCATGAGG - Intronic
1082097906 11:48146122-48146144 AAAAAGCAGGCAGAGCACAGTGG - Intronic
1082836140 11:57651627-57651649 TAAAAGCAGACAGAAGAACGTGG + Intronic
1082866589 11:57905393-57905415 TATAAGAAGGCATAGGAATGTGG - Intergenic
1082918846 11:58469754-58469776 TAAAAGCAGGCAGAGGAGCATGG - Intergenic
1083089790 11:60187967-60187989 TATAAGGAGGCATAAGAATGTGG + Intergenic
1083162947 11:60867036-60867058 TCAGAGCTGGCAGCGGAATGGGG - Intergenic
1084601184 11:70146875-70146897 AAAAAGCAGGCAGGGGAAGGTGG - Intronic
1085239688 11:75042592-75042614 TATAAGGAGGCATAAGAATGTGG + Intergenic
1085480007 11:76813941-76813963 TATAAGAAGGCATGGGAATGTGG - Intergenic
1085981869 11:81735102-81735124 AAAAAGCAGGCAGGAGAAGGTGG - Intergenic
1085998122 11:81947208-81947230 ATAAAGCAGGCAGAAGAAAGTGG + Intergenic
1086181360 11:83955742-83955764 TAAAAGCAGGCAGAGGAACATGG + Intronic
1086246708 11:84761542-84761564 TAAAAGCAGGCAGAAGAACATGG + Intronic
1086612251 11:88771553-88771575 ACAAAGCAGGCAGAAGAAGGTGG - Intronic
1086850450 11:91801368-91801390 TAAAAGGAGACAGAAGAGTGTGG + Intergenic
1086987371 11:93265108-93265130 TATAAGGAGGCATAAGAATGTGG + Intergenic
1087037683 11:93771482-93771504 AAAAAGCAGGCAAAAGAAGGTGG + Intronic
1087366934 11:97231958-97231980 TAAAAACAGGCAGAGGAATGTGG + Intergenic
1087415544 11:97850923-97850945 TAAAAGCAGGCAGAAGAATGTGG + Intergenic
1087430010 11:98041628-98041650 AAAGAGCAGGCAGAAGAAGGTGG - Intergenic
1087796180 11:102456472-102456494 TATAAGCAACCAGAGGAAAGTGG + Intronic
1087951012 11:104220317-104220339 TAAAAGCAGGTAGAAGAAGGTGG + Intergenic
1088031606 11:105258098-105258120 ATAAAGCAGGCAGAAGAACGTGG + Intergenic
1088097531 11:106117698-106117720 CGAAAGCAGGCAGAGGAACGTGG + Intergenic
1088102619 11:106171851-106171873 TAAAAGCTGGCAGAGGAACATGG + Intergenic
1088135258 11:106549303-106549325 TAAAAGAAGCCAGACAAATGAGG + Intergenic
1088147738 11:106703051-106703073 TAAAACCAGGCAGAAGAACATGG + Intronic
1088466213 11:110142068-110142090 TAAAAACAGTAAGAGAAATGGGG - Intronic
1088615465 11:111622806-111622828 TAAAAGCAGCCAGAGAAAAAAGG - Intronic
1089849236 11:121482152-121482174 TTAGTGCAGGCAGAGGACTGGGG + Intronic
1090209159 11:124905524-124905546 AAAAACCAGGCAGAAGAATGTGG - Intergenic
1090216714 11:124973328-124973350 TAAAAGGAGGCATAGTCATGGGG + Intronic
1090481248 11:127070639-127070661 AAAAAGCAAGCAGAAGAAGGTGG - Intergenic
1090819280 11:130326495-130326517 TAAAAGCAGTCAGAGGAGAATGG + Intergenic
1092887673 12:12939294-12939316 TGAAAGCATTCAGAAGAATGTGG + Intergenic
1092894290 12:12998132-12998154 GAAAAGCAAGCAGGGGAGTGAGG - Intronic
1093259214 12:16914228-16914250 TAAAAGCAGGCAGAGGAATGTGG - Intergenic
1093292288 12:17342689-17342711 GAAAAGCAGGCAGAAGAATGTGG - Intergenic
1093366802 12:18312035-18312057 TAAAAGCAGGCAGAGAAACGTGG - Intronic
1093527336 12:20117081-20117103 TGATAGCAGGCAGAGGAATGTGG - Intergenic
1093596612 12:20969800-20969822 ATAAAGCAGGCAGAAGAAAGTGG + Intergenic
1093920976 12:24858796-24858818 TATAAGAAGGCATGGGAATGTGG + Intronic
1094092526 12:26666840-26666862 AAAGAGCAGGCAGAGGAAGGAGG - Intronic
1094304877 12:29007593-29007615 TAAAAGCAGACAGAGGTAAGTGG + Intergenic
1094403260 12:30085647-30085669 TAAAAGCAGGCAGAAGAACGTGG - Intergenic
1094431220 12:30371894-30371916 TATAAGAAGGCATAGGAATATGG - Intergenic
1094472069 12:30812134-30812156 ACAAAGCAGGCAGAAGAAGGTGG - Intergenic
1094523218 12:31215041-31215063 AAAAAGCAGGCAGAAGACGGTGG - Intergenic
1094604342 12:31937710-31937732 TAAAAGCAGGCAGAAGAATGTGG + Intergenic
1094706903 12:32923047-32923069 TAAAAGCAGGCAGAGGAACTTGG - Intergenic
1094775759 12:33725430-33725452 TAAAAGCAGGGAGGTGAGTGGGG + Intergenic
1095280126 12:40341402-40341424 TAAAACCAGGCATTGGAATCTGG - Intronic
1095315626 12:40757332-40757354 TGAAAGAAGTCACAGGAATGTGG - Intronic
1095404765 12:41855885-41855907 TAATATTAGGCAGAGGAACGTGG - Intergenic
1096457130 12:51796894-51796916 AAAAAGCAGGCAGAAGAAGATGG - Intronic
1096458006 12:51803318-51803340 AAAAAGCAAGCAGAAGAAGGTGG - Intronic
1096735434 12:53649648-53649670 ACAAAGCAGGCAGAAGAAGGGGG - Intronic
1096769508 12:53925844-53925866 TAAGAGCAGGCAGAAGAGTCTGG + Intergenic
1096923939 12:55121018-55121040 TAAAAGCAGGCAGAGGAACATGG - Intergenic
1097471241 12:59994959-59994981 AAAAAGCAGGCAGGAGAAGGTGG - Intergenic
1097518397 12:60636670-60636692 AGAAAGCAGGCAGAGGAATGTGG + Intergenic
1097518575 12:60638565-60638587 AAAAAGCAAGCAGAGAAATGTGG + Intergenic
1097581568 12:61463809-61463831 TAAAAGCAGGCAGAAGAACATGG - Intergenic
1097598956 12:61668614-61668636 TAAAAGCAGGCAAAGAAATGTGG - Intergenic
1097624819 12:61987329-61987351 GAAAAGCAGGCAGAGATGTGTGG - Intronic
1097702526 12:62834789-62834811 CCAAACCAGGCAGAGGAAGGAGG + Intronic
1097833374 12:64249243-64249265 TAAAAACAGGCTGAGGACTATGG - Intergenic
1098024903 12:66191088-66191110 CAAAAGCAGACAGAGGATGGAGG + Intronic
1098070338 12:66667853-66667875 GGAAATCAGGCAGAGGAAGGAGG - Intronic
1098218608 12:68245268-68245290 TTAAAGCAGGCAGAAAAAAGAGG + Intergenic
1098517675 12:71396300-71396322 TAAAAGCAGAGAGATGAATTAGG - Intronic
1098824162 12:75271808-75271830 TCAAAGCAGACAGAGGAATGTGG - Intergenic
1099224201 12:79949535-79949557 TAAAAAAAGGCAGAGGGAAGGGG - Intergenic
1099452085 12:82820136-82820158 TAAAAGCAGGCAGAAGAACATGG - Intronic
1099697776 12:86043498-86043520 TAAAAGCAGGTAGAAGAATGTGG - Intronic
1099734226 12:86547308-86547330 GAAGAGCAGGAAGAGGAAGGGGG - Intronic
1099735320 12:86561425-86561447 ATAAAGCAGGCAGAAGAAGGTGG + Intronic
1099736142 12:86568247-86568269 ATAAAGCAGGTAGAGGAAGGTGG + Intronic
1100074624 12:90765078-90765100 TAAAAACAGGCAGAGGAACATGG + Intergenic
1100078117 12:90813118-90813140 TGAGAGCAGGTAGAGGAATCAGG + Intergenic
1100266572 12:92982330-92982352 TAAAAGCAGGCGGAAGAACATGG + Intergenic
1100849843 12:98697955-98697977 TTAAAGCACGCAGAGGCCTGGGG + Intronic
1100899843 12:99225596-99225618 AAAAAGCAGGCAGAATAAAGTGG + Intronic
1100937553 12:99687235-99687257 TAAAAGCAGCCAGAGAAAAAAGG - Intronic
1100970875 12:100068948-100068970 TAAAAGTAGGCAGAGCATGGTGG + Intronic
1101158011 12:101945947-101945969 CAAAAGAGGGCAGAGGAATGAGG - Intronic
1101192654 12:102351150-102351172 TAAAAGCAGGCAGAGGAATGTGG - Intergenic
1101213716 12:102560396-102560418 TAAAAGCAGGCAGAGGAACGTGG + Intergenic
1101275062 12:103190288-103190310 ACAAAGCAGGCAGAAGAAGGGGG - Intergenic
1101506063 12:105347577-105347599 ATAAAGCAGGCAGAAGAAGGTGG - Intronic
1101713838 12:107293208-107293230 ATAAAGCAGGCAGAAGAAGGTGG + Intergenic
1101755704 12:107619086-107619108 TTAAGGCAGGCTGAGGACTGAGG + Intronic
1102154144 12:110710930-110710952 TAAAAGGAGGCTGAGGCAGGTGG + Intergenic
1102395845 12:112585159-112585181 TAAAAGCAGGCAGAGGAACGTGG - Intronic
1102471044 12:113160105-113160127 TAAAAACAGGCTGAGAAGTGAGG + Intronic
1102497812 12:113331489-113331511 TAAAAGCAGGCAGAAGAATGTGG + Intronic
1102637841 12:114340036-114340058 TAAAAGGAAGCAGAGGAACATGG - Intergenic
1102669901 12:114609297-114609319 TAAAAGCAGCCAGAAGAACATGG + Intergenic
1102717892 12:114989964-114989986 TAAAAGCAGGCAGAAGAACATGG - Intergenic
1102737501 12:115175712-115175734 TAAAAGCAGGCAGAGGAACGTGG - Intergenic
1102763479 12:115410199-115410221 TAAAAGCAGGCAGAGGAAGATGG + Intergenic
1102790174 12:115638172-115638194 AAAAAGCAGGCAGAAGAATGTGG - Intergenic
1103148613 12:118617421-118617443 TAAAAGCAGGCAGAGGAATGTGG + Intergenic
1103396865 12:120613989-120614011 ATAAAGCAGGCAGAAGAAGGTGG + Intergenic
1103865561 12:124049288-124049310 GCAAAGCATGCAGAGGAATGAGG - Intronic
1104021407 12:124994455-124994477 TCAAAGCAGGAGGAGGAGTGGGG - Intronic
1104311190 12:127655517-127655539 GTAAAGCAGGCAGAAGAAGGAGG + Intergenic
1104327171 12:127810648-127810670 ATAAAGCAGACAGAAGAATGTGG - Intergenic
1104366360 12:128181401-128181423 TAAAAGCAGGCAGAAGAAGGTGG - Intergenic
1104548082 12:129730737-129730759 TAAAAACAGGCAGAGGAACCTGG + Intronic
1105276207 13:18929310-18929332 TAAAAATAGGCAGAGGAACATGG - Intergenic
1105276521 13:18933488-18933510 TAAAAGCAGACAGAAGAACCTGG + Intergenic
1105289790 13:19045471-19045493 TAAAAGCAGGCAGAGGAACATGG - Intergenic
1105632262 13:22182050-22182072 TAAAAGCAGGCAGAAGAACGTGG - Intergenic
1105752827 13:23437233-23437255 TAAAAGCAGGCAGAGGAATGTGG + Intergenic
1106080011 13:26492465-26492487 TGAAAGCAGGCAGAAAAGTGTGG - Intergenic
1106331055 13:28740044-28740066 TAAAAGCAGGCGAAAGAACGTGG - Intergenic
1106380952 13:29238606-29238628 AAAAAGCAGGCAAAAGAAGGTGG - Intronic
1106880185 13:34120763-34120785 GAAACTCAGGAAGAGGAATGTGG - Intergenic
1106905684 13:34406888-34406910 TATAAGCAGGCAGAAGAACGTGG + Intergenic
1107055328 13:36097142-36097164 TAAAAGCAGATAGAAAAATGAGG + Intronic
1107234074 13:38147233-38147255 CAAAAGCAGGAAGAGGAACAAGG - Intergenic
1107308745 13:39053043-39053065 TAAAAGCAAGCAGAGGAACGTGG + Intergenic
1107385600 13:39905072-39905094 GTAAAGCAGGCAGAAGAAGGTGG - Intergenic
1107518541 13:41156182-41156204 TATAAGAAGGCATGGGAATGTGG - Intergenic
1107972067 13:45653079-45653101 CAAAAGCAGGCGGAAGAAGGTGG - Intergenic
1108098029 13:46924994-46925016 TAAAAGCAGGCAGAAGAACGTGG + Intergenic
1108163042 13:47662739-47662761 TATAAGCAGGCAGAAAAATGTGG + Intergenic
1108446178 13:50511086-50511108 TAAAAGCAGGCAGAAGAATGTGG + Intronic
1108466468 13:50721097-50721119 CTAAAGCAGGCAGAAGAAGGTGG + Intronic
1108473249 13:50788292-50788314 TAAGAGGAGGCTGAGGAATGTGG - Intronic
1108732204 13:53246767-53246789 ACAAAGCAGGCAGAAGAAAGGGG - Intergenic
1108735389 13:53278522-53278544 TAAAAGCAGACAGAGGAACGTGG - Intergenic
1108876028 13:55052137-55052159 TAAAAGCAGGCAGAAGAATGTGG - Intergenic
1108925016 13:55731532-55731554 ACAAAGCAGGCAGAGGAAGATGG + Intergenic
1108933365 13:55859756-55859778 TAAAAACAGGCAGAAGAATGTGG - Intergenic
1109048207 13:57440305-57440327 TAAAAGCTGGCAGAGGAACAAGG + Intergenic
1109155381 13:58902974-58902996 ATAAAGCAGGCAGAAGAAAGTGG + Intergenic
1109241821 13:59898959-59898981 TAAAAGTAGGCAGAGGAACATGG + Intronic
1109333244 13:60958363-60958385 AAAAAGCAGACAGAAGAAGGTGG + Intergenic
1109379649 13:61542994-61543016 TAAAAGCCAGCAGAGGAATATGG + Intergenic
1109415745 13:62037197-62037219 TAAAAGCAGGTAGAGGAATGTGG - Intergenic
1109664867 13:65521050-65521072 TGGAAGCAGCCAGATGAATGTGG - Intergenic
1109713125 13:66184620-66184642 ATAAAGCAGGCAGAAGAATGTGG - Intergenic
1109799925 13:67363190-67363212 TAAAAGCAGGCAGAAGAACGTGG - Intergenic
1109927087 13:69157960-69157982 TAAAAGGAGGCAGAAGAACGTGG - Intergenic
1110084721 13:71363975-71363997 CTAAAGCAGGTAGAGGAACGTGG - Intergenic
1110161088 13:72379567-72379589 TGAAAGCAGGCAGAAGAATGTGG + Intergenic
1110234197 13:73199206-73199228 TTAAGGCTGGCAAAGGAATGAGG - Intergenic
1110363061 13:74649892-74649914 TAAAAGCAGGCAGAGGAACATGG + Intergenic
1110378271 13:74819548-74819570 TAAAAGCAGGCAGAAGAACGTGG + Intergenic
1110409734 13:75191157-75191179 CAAAAGCAAGCAGAGGAACATGG + Intergenic
1110502537 13:76245228-76245250 TAAAAGCAGGCAGAAGAGCGTGG + Intergenic
1110701701 13:78556023-78556045 TTAAAACAGGCAGTGGAAGGGGG - Intergenic
1110706358 13:78604685-78604707 TATAAGCAGGCAGAGATATGAGG - Intergenic
1110738230 13:78963506-78963528 TAAAAGCAGGCAGAAGAATGTGG - Intergenic
1110760171 13:79222555-79222577 AAAAAACAGGCAGAGGAACCTGG - Intergenic
1110903414 13:80854344-80854366 TAAAAGGAGCCAGAGGTATGAGG - Intergenic
1110948113 13:81450106-81450128 TAAAAGCAGACAGAGAAATGTGG + Intergenic
1111086499 13:83381477-83381499 TAAAAGCAAGCAGAAGAACGTGG - Intergenic
1111271727 13:85895573-85895595 TAAAAGCAGACAGAGGAATGTGG + Intergenic
1111302782 13:86366773-86366795 TAAAAGCAGGCAGAGGAATGTGG - Intergenic
1111317811 13:86584338-86584360 TAAAAGCGAGCAGAGGAACATGG + Intergenic
1111476113 13:88750182-88750204 TAAAAGGAGGCTGAGGCAGGTGG + Intergenic
1111679563 13:91426712-91426734 TAAAAGCAGGCAGAGGAATATGG - Intronic
1111741412 13:92210002-92210024 TAAAAGCAGGCAGAAGAACGTGG - Intronic
1111802348 13:92996355-92996377 TAAAAGCAGGCCGAAGAACGTGG - Intergenic
1111811653 13:93099051-93099073 AAAAAGCAGGCAGAAGAAGGTGG + Intergenic
1111906871 13:94265422-94265444 TAAAAGCAGTCAGAAGAACGTGG - Intronic
1111957963 13:94779031-94779053 TAAAAGCAATCAGAAGAACGTGG + Intergenic
1112109891 13:96284502-96284524 TAAAAGCAGGCAGAAGAACATGG - Intronic
1112183473 13:97107206-97107228 TATAAGCTGGCAGAAGAACGTGG - Intergenic
1112206113 13:97324892-97324914 AAAAAGCAGGCAGAAGGATGTGG - Intronic
1112228220 13:97562005-97562027 TAGAAGCAGGCAGAAGAATGTGG + Intergenic
1112322794 13:98422392-98422414 TAAGAGAACGCAGAGGACTGAGG + Intronic
1112322886 13:98423112-98423134 TAAAAGTAGGCAGAAGAACATGG - Intronic
1112686753 13:101837933-101837955 TAAAAGCAGGCAGAAGAACGTGG + Intronic
1112863518 13:103864791-103864813 TAAAAACAGGCAGAAGAACATGG + Intergenic
1112900829 13:104354709-104354731 TAAAAGCAGGCGGGGGAATGTGG - Intergenic
1112953440 13:105030977-105030999 AAAAAGCAGGAAGAAGAAAGTGG - Intergenic
1112958381 13:105090218-105090240 TAGAATCTGGAAGAGGAATGTGG - Intergenic
1113024929 13:105929823-105929845 TAAAAGCAGGCAGAAGAACGTGG + Intergenic
1113027623 13:105958282-105958304 CAAAAGCAGGCAGAAGAACGTGG - Intergenic
1113168614 13:107472558-107472580 TAAAAGCAGGCAGAGGAACATGG + Intronic
1113218695 13:108072986-108073008 ATAAAGCAGGCAGAAGAAGGTGG - Intergenic
1113218795 13:108074298-108074320 ACAAAGCAGGAAGAAGAATGTGG - Intergenic
1113267260 13:108633495-108633517 TAAAAGCAGGCAGAGGAACATGG - Intronic
1113351709 13:109535925-109535947 TAAAAGAAGGCAGACCAATGAGG + Intergenic
1113363022 13:109648974-109648996 TAAAAATGGGCAGAGAAATGAGG + Intergenic
1113475607 13:110578618-110578640 TGAAAGAAGGAAGAGCAATGTGG + Intergenic
1113519161 13:110926446-110926468 TAAAAGCAGGCAGGAGAACTTGG + Intergenic
1113700690 13:112385292-112385314 TATAAGAAGGCATAGGAATATGG - Intronic
1114038498 14:18653100-18653122 TAAAAGCAGGCAGAGGAATATGG - Intergenic
1114120123 14:19661943-19661965 TAAAAGCAGACAGAGGAATATGG + Intergenic
1114236201 14:20826058-20826080 TATAAGGAGGCATAAGAATGTGG - Intergenic
1114379887 14:22191320-22191342 TAAAAGCAGGCAGAGGAATGTGG - Intergenic
1114790019 14:25647682-25647704 TATAAGAAGGCACAGGAATGTGG - Intergenic
1114876387 14:26725173-26725195 TACAATCAGTCAGAGGAGTGGGG + Intergenic
1114932444 14:27490560-27490582 TAAAAGCAGGCAGAAGAACGTGG + Intergenic
1114973308 14:28061731-28061753 AAAAAACAGGCATAGGAATAAGG - Intergenic
1115060870 14:29188108-29188130 ACAAAGCAGGCAGAAGAAGGTGG + Intergenic
1115068427 14:29294037-29294059 TTAAAGTAGGCAGAAGAATTTGG - Intergenic
1115391652 14:32860969-32860991 ACAAAGCAGGCAGAAGAAGGTGG + Intergenic
1115656367 14:35447466-35447488 TAAAAGCAGGCAGAGGAACGTGG - Intergenic
1115908975 14:38234508-38234530 TAAAAGAAGGCAGAAGGAAGTGG - Intergenic
1115934657 14:38538220-38538242 TAAAAGCAGGCAGAAGAACGTGG - Intergenic
1115982443 14:39069099-39069121 TAAAAGGGAGCAGAGAAATGGGG - Intronic
1116067817 14:40007035-40007057 TAAAAGCAGGCAAAGGAACATGG + Intergenic
1116278065 14:42862303-42862325 TAAAAACAGGCAGAGGAATGTGG - Intergenic
1116531911 14:45981826-45981848 TAAAAGCAGGCAGACGAGTGTGG - Intergenic
1116625405 14:47256444-47256466 GAAATGTAGGCAGAGAAATGGGG - Intronic
1116725759 14:48559929-48559951 TATAAGGAGGCATAAGAATGCGG + Intergenic
1116747868 14:48844948-48844970 GAAAAGCAGGCAGCAGAAGGTGG + Intergenic
1116754514 14:48929311-48929333 AAAAAGCAGGCAGAAGAACGTGG + Intergenic
1117179647 14:53179087-53179109 TATAAGGAGGCATAAGAATGTGG - Intergenic
1117222096 14:53616656-53616678 TAAAAGCAGGCAGAAGAACATGG - Intergenic
1117331705 14:54719067-54719089 TACAAGAAGGAAGGGGAATGGGG - Intronic
1117851229 14:59972006-59972028 CAATGCCAGGCAGAGGAATGTGG - Intronic
1117860879 14:60091781-60091803 TTAACGCAGGCAGAGGGGTGTGG - Intergenic
1118053632 14:62056039-62056061 AAAAAGCAGGGAGAAGAACGTGG - Intronic
1118440257 14:65805671-65805693 TAAAAGCAGGCAGAGGAACATGG - Intergenic
1118440883 14:65810562-65810584 TAAAAGCAGGCTGAAAAAAGAGG - Intergenic
1118449691 14:65888798-65888820 TAAAAGCAGGCAGAGGAACGTGG - Intergenic
1118466362 14:66034708-66034730 TATAAGCAGGCAGAGGAATGTGG + Intergenic
1118475637 14:66114264-66114286 TAAAAGCAGTCAGAGGAATGTGG - Intergenic
1119115071 14:72012543-72012565 TAACAGCAAGCAGAGAAGTGGGG - Intronic
1120187182 14:81405943-81405965 ATAAAGCAGGCAGAAGAAAGTGG + Intronic
1120265942 14:82251418-82251440 TAAAAGAACACAGACGAATGTGG + Intergenic
1120356299 14:83438714-83438736 TAAAAGCAGGCAGAGGATCGTGG + Intergenic
1120379441 14:83755816-83755838 GAAAAGCAGGAAGAGAAATACGG - Intergenic
1120596389 14:86442501-86442523 TAAAAGCAGGCAGAAGAATGTGG - Intergenic
1120626046 14:86827702-86827724 AAAAAGCAGGCAGAAGAACATGG + Intergenic
1120654770 14:87176807-87176829 TAAAAGCAGGCAGAAGAACATGG + Intergenic
1120655894 14:87189567-87189589 TAAAAGCAGACAGAAGAATGTGG + Intergenic
1120676852 14:87430684-87430706 TAAAAGCAGGCAGAAGAACGTGG + Intergenic
1120760940 14:88284660-88284682 AAAAAGCAGGCAGAAGAAGGTGG - Intronic
1120822107 14:88921511-88921533 AAAAAGTAGGCAGAAGAAGGTGG + Intergenic
1120924778 14:89787098-89787120 ATAAAGCAGGCAGAAGAAGGTGG + Intergenic
1121082519 14:91119804-91119826 CAAAAGCAGGCAGAGGAACATGG + Intronic
1121149481 14:91618490-91618512 GAGAAGCAGGCTGAGGAATGAGG - Intronic
1121490650 14:94356708-94356730 ATAATGCAGGGAGAGGAATGGGG - Intergenic
1121701954 14:95961412-95961434 CAGAAGCTGGAAGAGGAATGGGG + Intergenic
1121861235 14:97320786-97320808 TAAAAGCAAGCAGAAGAACATGG + Intergenic
1122100685 14:99407391-99407413 TATAGCCATGCAGAGGAATGAGG - Intronic
1122382615 14:101319968-101319990 TATAAGGAGGCATAAGAATGTGG + Intergenic
1122459602 14:101884220-101884242 ATTAAGCAGGCAGAGGAACGTGG - Intronic
1122503537 14:102217504-102217526 TTAAAGCTGGCAGAGGTACGTGG + Intronic
1122605749 14:102946543-102946565 TAAAAACCGGCTGAGGAATCAGG - Exonic
1122765809 14:104069047-104069069 GTAAAGCAGGCAGAAGAAAGTGG + Intergenic
1123072678 14:105649363-105649385 TACAAGCAGAGAGAGAAATGGGG + Intergenic
1123092705 14:105748888-105748910 TACAAGCAGAGAGAGAAATGGGG + Intergenic
1202900605 14_GL000194v1_random:34364-34386 ACAAAGCAGGCGGAGGAAGGTGG + Intergenic
1123795871 15:23769399-23769421 TAAAAGCAGGAAGAGGAACGTGG - Intergenic
1123973935 15:25534905-25534927 AAAAAGCAGGCAGAAGAAGGTGG - Intergenic
1124065674 15:26341478-26341500 AAAAAACAGGCAGAAGAACGTGG - Intergenic
1124392665 15:29273697-29273719 TAAAAGCAGGCAGAAGAACGTGG + Intronic
1124474194 15:30017731-30017753 TAAAAGCAGCTAGAGAAAAGGGG - Intergenic
1124529525 15:30492467-30492489 CTAAAGCAGGCAGAGAACTGTGG - Intergenic
1125134332 15:36324214-36324236 TCATCACAGGCAGAGGAATGGGG - Intergenic
1125282631 15:38058755-38058777 AAAATGCAGACTGAGGAATGTGG - Intergenic
1125490426 15:40143964-40143986 TAAAAGCAGCCAGAGAAAAAAGG + Intergenic
1126212700 15:46117918-46117940 ATAAAGCAGGCAGAAGAAAGTGG - Intergenic
1126318501 15:47396613-47396635 TAAAGGCAGGCAGAGGAATGCGG - Intronic
1126750791 15:51875002-51875024 AAAAAGCAGGGAGGGGCATGTGG - Intronic
1126874462 15:53025053-53025075 TAAAAGCAGGCAGAGAAACATGG - Intergenic
1128491521 15:68151261-68151283 TAAAAGCAGCAAAAAGAATGTGG - Intronic
1129000724 15:72331343-72331365 ATAAAGCAGGCAGAAGAACGTGG - Intronic
1129095081 15:73197967-73197989 TAAAAGCATGGACAGGCATGGGG - Intronic
1129137565 15:73568383-73568405 AAAAGGCAGGCTGAGGAAGGTGG + Intronic
1129152301 15:73696740-73696762 GAGTACCAGGCAGAGGAATGGGG + Intronic
1129635925 15:77317605-77317627 TAAAAACAGACAGAAGAATGGGG + Intronic
1129685137 15:77681726-77681748 GAAGAGCTGGCACAGGAATGAGG + Intronic
1130066381 15:80608368-80608390 TAAAAGCAGGCAGAAGAATGTGG + Intergenic
1130336839 15:82963779-82963801 TAAAAGCAGCCAGTGGTCTGAGG - Intronic
1130391445 15:83459179-83459201 ATAAACCAGGCAGAAGAATGTGG - Intronic
1130882677 15:88068755-88068777 TCAAAGCAGGCAGAGCAAGAAGG + Intronic
1130973654 15:88756074-88756096 TAAAAGCAGGCAGAGGACCATGG - Intergenic
1130982017 15:88819155-88819177 TACAGGCTGGCAGAGGACTGGGG + Intronic
1131274122 15:90966417-90966439 GCAAAGTAGGCACAGGAATGGGG + Exonic
1131509046 15:93039053-93039075 TAAAAGCGGGCAGAGGAATGTGG + Intronic
1131701281 15:94938761-94938783 TAAAAGCAGGCAGAGGAAGGTGG - Intergenic
1131724319 15:95205334-95205356 ATAAAGCAGGTAGAAGAATGTGG + Intergenic
1131914514 15:97250265-97250287 TATAAGAAGGCATAGGAATATGG - Intergenic
1133623597 16:7549714-7549736 TAAAGGCAGGCAGAAGAAGGTGG - Intronic
1133662498 16:7932954-7932976 TAAAAGCGGGCAGAAGAACGTGG - Intergenic
1133680882 16:8118719-8118741 TAAAGGCCAGCAGAGGAACGTGG - Intergenic
1133727378 16:8550141-8550163 AAAAAGCAGGCAGAAGATGGTGG - Intergenic
1133911571 16:10070844-10070866 GAAAAGCAGACAAAGGAAAGAGG - Intronic
1134350582 16:13434199-13434221 TAAAAGCAGGCAGAGGAATGTGG - Intergenic
1134374876 16:13662500-13662522 AAAAAGCCGGCAGAAGAAGGTGG + Intergenic
1134996293 16:18741400-18741422 TAAAAGCAGGAAGATGAACATGG - Intergenic
1135498724 16:22975324-22975346 CAAAGGTAGGCAGAGGAGTGGGG - Intergenic
1135518975 16:23158908-23158930 TAAAAGCAGGCCGCCGAACGTGG + Intergenic
1135800210 16:25487540-25487562 TAACAGCAGGTAGAGAAAAGGGG - Intergenic
1135810556 16:25582873-25582895 TAAAAGGAGGCAGAGGAGGAGGG + Intergenic
1135934099 16:26764596-26764618 TAAAAGCAGGCAGAGGAACGTGG - Intergenic
1135959552 16:26984398-26984420 TAAAAGCAGGCAGAGTAACATGG - Intergenic
1136016157 16:27402486-27402508 AGAAAGCAGGCAGAGGCCTGGGG - Exonic
1136070235 16:27783048-27783070 TAGAAGCAGGTTAAGGAATGTGG + Intergenic
1136218714 16:28813387-28813409 TAAAAGAAGGCAGGACAATGCGG + Intergenic
1136251366 16:29007686-29007708 TAAAAGCAGGCAGAAGAAGTTGG + Intergenic
1137687536 16:50396886-50396908 TAAAATCAAGCAGAAGAATGTGG - Intergenic
1137770160 16:51009876-51009898 TAAAAGAAGGGAGTGAAATGTGG + Intergenic
1137906260 16:52325149-52325171 TAAAAGCAGGCAGAGGAATGTGG + Intergenic
1137973523 16:53010229-53010251 TGAAAGCAGTAAGAGGAAAGAGG - Intergenic
1137999216 16:53256807-53256829 TGAAAGCAGAGAGGGGAATGGGG - Intronic
1138033889 16:53583071-53583093 ATAAAGCAGGCAGAGGAACGTGG + Intergenic
1138055067 16:53824226-53824248 TACGAGGAGGCAGAGGAAGGCGG - Intronic
1138268872 16:55680528-55680550 CAAAAGCAGGCAGAAGAACATGG - Intronic
1138493506 16:57392545-57392567 TAAAAGCAGGCAGAAGAACATGG + Intergenic
1138764845 16:59589965-59589987 TAAAAACAGGTAGAAGAACGTGG + Intergenic
1138789858 16:59890685-59890707 ATAAAGCAGGCAGAAGAAGGTGG + Intergenic
1138971982 16:62156117-62156139 TTAAAGCAGGCAGAAGAATGTGG - Intergenic
1139041500 16:63004461-63004483 TCAGAGCAGGGAGAGGAAGGGGG - Intergenic
1139216973 16:65135567-65135589 TAAAAGCAGGCAGAAGAATGCGG + Intergenic
1139312321 16:66038019-66038041 AAAAAGTAGGCAGAAGAATGTGG - Intergenic
1139356972 16:66372391-66372413 TAAATCCAGGCAGAGGAGAGAGG + Intronic
1139597234 16:67965472-67965494 GAAAACCATGCAGAGGAAGGGGG - Intronic
1139734183 16:68973145-68973167 TAGAAGCAGGGAGACCAATGAGG + Intronic
1140594998 16:76398177-76398199 TAAAAGCAGGCAGAAGAACATGG - Intronic
1141260260 16:82447024-82447046 TATAAGGAGGCAGAGGCATAAGG + Intergenic
1141267582 16:82510885-82510907 ATAAAGCAGGCAGAAGAAAGTGG - Intergenic
1141547618 16:84781793-84781815 TAAAAGCAGGCAGGAGAATGTGG + Intergenic
1141798842 16:86293493-86293515 CAAAAGCAGGCTGAGAAATCGGG - Intergenic
1141908080 16:87040840-87040862 TAAAAACTGCCAGAGTAATGAGG + Intergenic
1142498233 17:317693-317715 CAAAAGCAGGAAAAGAAATGAGG + Intronic
1142566540 17:843936-843958 AGAAAGGAGGCATAGGAATGAGG + Intronic
1143265025 17:5630140-5630162 TAAAAGCAAGCAGGAAAATGTGG + Intergenic
1143277909 17:5727396-5727418 TAAAAACAGGCAGAGGAATATGG + Intergenic
1143353485 17:6307027-6307049 ACAAAGCAGGCAGAAGAAGGGGG + Intergenic
1143358302 17:6347418-6347440 GAAAGCCAGGCAGAGGAATTGGG - Intergenic
1143464051 17:7123788-7123810 TAAATGTAGGCAGAGGAACATGG + Intergenic
1143669516 17:8386758-8386780 CAAATCCAGGAAGAGGAATGTGG - Intergenic
1143889407 17:10091083-10091105 TAAAAGCAGGGAGAGCATTGAGG - Intronic
1144229926 17:13191849-13191871 TAAAAGCAGGCAGGAAAATGTGG - Intergenic
1144259701 17:13506216-13506238 CAAAAGCAGGAATAGGAATAAGG + Intronic
1144735762 17:17554476-17554498 TAAAAGCAGCCAGAGCAGGGAGG - Intronic
1146047140 17:29518163-29518185 TTAAAGAAAGCAGAAGAATGTGG - Intronic
1146060315 17:29601917-29601939 TAAAAGCATTCAAAGAAATGAGG - Intronic
1146417430 17:32648861-32648883 CAAAAGAAAGCAGAGAAATGTGG - Intronic
1146636832 17:34512794-34512816 CAAAAGCAGGGAGAAGAATTAGG - Intergenic
1146737637 17:35252543-35252565 TAAAAGCATCCAGAGGAAAAAGG - Intronic
1147050075 17:37787602-37787624 TGAATGCAGGCTGAGGGATGTGG - Intergenic
1148960445 17:51388140-51388162 ATAAAGCAGGCAGAAGAAGGTGG - Intergenic
1148995823 17:51708724-51708746 ATAAAGCAGGCAGAAGAACGTGG + Intronic
1149077906 17:52618059-52618081 CAAAAGCAGGCAGAAGAATGTGG - Intergenic
1149095761 17:52838493-52838515 TAAATGCAGGCAGAAGAACATGG - Intergenic
1149100962 17:52906521-52906543 TAAAAGCAGACACAGACATGAGG + Intergenic
1149186299 17:54001689-54001711 GGAAAGCATGAAGAGGAATGTGG - Intergenic
1149187424 17:54016028-54016050 TAAAAGCAGGCAGAGGAACATGG - Intergenic
1149207848 17:54268893-54268915 TAAAAGCAGGCAGAAGAACATGG - Intergenic
1149231079 17:54535530-54535552 TAAATGCAGGCAGAGGAACGTGG - Intergenic
1149397695 17:56261712-56261734 TAAAAGCAGGCAGAAGAACGTGG - Intronic
1149411472 17:56412532-56412554 TAAAAGCAGGCAGAGGAATGTGG + Intronic
1150343681 17:64388042-64388064 TAAAACAAGGCAGAGGCCTGAGG + Intronic
1150348324 17:64421882-64421904 TAAAAGGAGGCCGAGGCAGGTGG + Intergenic
1150466118 17:65394102-65394124 AAAAAGAAGGTAGAGGAAGGTGG + Intergenic
1150517299 17:65826990-65827012 ATAAAGCAGGCAGAAGAAGGTGG + Intronic
1150631833 17:66885370-66885392 GAGAAGCAGGGAGAGGACTGGGG - Exonic
1150941863 17:69701518-69701540 TAAAAACAGGCAGAGGAACTTGG - Intergenic
1151045985 17:70919866-70919888 ACAAAGCAGGCAGAAGAAGGTGG - Intergenic
1151069058 17:71187321-71187343 TACAAGCAGGCAGAGGAGCGTGG - Intergenic
1151184942 17:72356955-72356977 TAAAAGCAGGCAGAGGAGCGTGG + Intergenic
1151219590 17:72602659-72602681 TAAAAGCAGACAGAGAAGTTTGG + Intergenic
1151368545 17:73632324-73632346 TTAAAGCAGGCAGAGGAACGTGG + Intronic
1152716025 17:81901256-81901278 TACAAGCAGGCAGAGGAACGTGG - Intronic
1153096252 18:1407921-1407943 TAAAAGAAGGCAAAGGAATAAGG + Intergenic
1153104096 18:1507981-1508003 TAAAAGCAGGCAGAGGAACATGG + Intergenic
1153175184 18:2363866-2363888 ATAAAGCAGTCAGAGGAACGTGG + Intergenic
1153319977 18:3763186-3763208 TAAAAGCAGGCAGAAGAACGTGG + Intronic
1153598710 18:6756887-6756909 ATAAAGCAGGCAGAAGAAGGTGG - Intronic
1153602143 18:6791270-6791292 ATAAAGCAGGCAGAGGAACATGG - Intronic
1153626724 18:7028379-7028401 TAACAGCAGGCAGAGAAAAAAGG + Intronic
1153684904 18:7536018-7536040 TAAAAGCAGGCAGAGGAATGTGG - Intergenic
1153826480 18:8879931-8879953 TATAAGGAGGCATAAGAATGTGG - Intergenic
1153962850 18:10154102-10154124 TAAGAGCAGCCAAAGGAAGGAGG - Intergenic
1154053050 18:10981763-10981785 TAAAAGCAGGCAGAGGAATGTGG + Intronic
1154071490 18:11156247-11156269 TAAAAGCAGGCAGAGGAACGTGG - Intergenic
1155551233 18:26967847-26967869 TAAAAGCAGGCAGAAGAAGGTGG + Intronic
1155589482 18:27410281-27410303 TAAAAGCGGGCAGAAGAACATGG + Intergenic
1155618248 18:27746100-27746122 TAGAAGCAGGCAGACAAACGTGG + Intergenic
1155663917 18:28283972-28283994 AAAAAGCAGGCAGAGGAAGATGG + Intergenic
1155679817 18:28475372-28475394 GAAAAGAAGGCAGAGCAGTGAGG + Intergenic
1155741633 18:29296825-29296847 AGAAAGCAGGCAGAAGAAGGTGG - Intergenic
1155878302 18:31113435-31113457 TAAAAGAGGGTAGAGGAATGGGG - Intergenic
1156169862 18:34469626-34469648 ATAAAGCAGGCAGAAGAAAGTGG + Intergenic
1156189196 18:34698777-34698799 TAAAAGCAGGCAAAAGAACGTGG - Intronic
1156421918 18:36963142-36963164 TAAAAAGAGGCAGAGGAAGGTGG + Intronic
1156510049 18:37628652-37628674 TAAAAGCAGGCAGAAGAACGTGG - Intergenic
1156593175 18:38515558-38515580 TAAAATCAGATAGAGGAATGGGG + Intergenic
1156604794 18:38653706-38653728 ATAAAGCAGGCAGAAAAATGTGG + Intergenic
1156890500 18:42184976-42184998 TAAAAGCAAGCAGAAGAACGTGG - Intergenic
1156896569 18:42253544-42253566 TGAAAGGAGGCAGAGGAACATGG - Intergenic
1156959153 18:43002274-43002296 TAAAAGCAGGCAGAAGAAAGTGG - Intronic
1156973900 18:43193113-43193135 TAAAAGCAGGCAGAAGAACGTGG - Intergenic
1157180808 18:45496457-45496479 ACAAAGCAGGCAGAAGAAGGTGG + Intronic
1157687487 18:49654123-49654145 GAAAAGCAGGCAGAGGAACATGG - Intergenic
1157806986 18:50665569-50665591 TAAAGGAGGGCAGAGGAATGGGG - Intronic
1157821111 18:50770037-50770059 TAAAAGCAGGCAGAAGAACATGG + Intergenic
1158037394 18:53050145-53050167 ATAAAGCAGGCAGAAGAAGGTGG - Intronic
1158175862 18:54654987-54655009 AAAAAGCAGGCGGAAGAAGGTGG - Intergenic
1158219702 18:55137638-55137660 AAAAAGCACAGAGAGGAATGAGG + Intergenic
1158323322 18:56287450-56287472 TAAAAGCAAGCAAATGAATCAGG + Intergenic
1158707628 18:59807488-59807510 TGGAAGCAGCCAGAGGAAGGAGG - Intergenic
1158723821 18:59949969-59949991 AAAAAGCAGGCAGGAGAAGGTGG + Intergenic
1158906673 18:62019821-62019843 TAAAAGGAGGCACAAGACTGTGG + Intergenic
1158916531 18:62137118-62137140 ATAAAGCAGGCAGAAGAATGTGG + Intronic
1159072350 18:63640118-63640140 TAAAAGTAGGAAGAGGAGGGAGG - Intronic
1159151600 18:64530150-64530172 ATAAAGCAGGCAGAAGAATGTGG - Intergenic
1159200726 18:65180566-65180588 TAAAAGCAGGCAGGGGAATGTGG - Intergenic
1159208560 18:65285765-65285787 ATAAAGCAGGCAGAAGAATTTGG + Intergenic
1159269564 18:66130983-66131005 AAAAAGCAGGCAGAAGAAAGTGG + Intergenic
1159429943 18:68338145-68338167 TAAAAAGAGGCAGATTAATGTGG - Intergenic
1159481544 18:68996210-68996232 TAAAAGCAGGCAGAGGAACATGG + Intronic
1159481794 18:68998758-68998780 TAAAAGCAGGCAGAGGAGCATGG - Intronic
1159642671 18:70881894-70881916 ATAAAGCAGGCAGAAGAAAGTGG + Intergenic
1159674622 18:71266184-71266206 ATAAAACAGGCAGAGGAACGTGG - Intergenic
1159683197 18:71381297-71381319 TAAAAGCAGGCAGAGGAACATGG - Intergenic
1159704436 18:71668883-71668905 TAAAAGCAGCCAGAAGAACGTGG - Intergenic
1159756884 18:72376717-72376739 TAAAAGCAGGTAGACGAACGTGG - Intergenic
1159780686 18:72657243-72657265 TAAAAACAGGGAGATGAATGTGG + Intergenic
1159804541 18:72940308-72940330 TAAAAGCAGACAGAAGAACGTGG - Intergenic
1160092235 18:75838366-75838388 AAAAAGCAGGCAGAAGAAGGTGG + Intergenic
1160092773 18:75842560-75842582 AAAAAGCAGGCGGAAGAAGGCGG + Intergenic
1160452954 18:78978468-78978490 TAAAGGCAGGCGGAAGAACGCGG + Intergenic
1160963163 19:1733650-1733672 GAAAAGCAGGCAAAGGCTTGGGG - Intergenic
1161362554 19:3859137-3859159 TAAAAGCAGGCAGAGGAACGTGG + Intronic
1161512366 19:4678902-4678924 ACAAAGCAGCCAGAGAAATGTGG + Intronic
1161879009 19:6934105-6934127 CAAAGGCAGGCAGAGAAGTGGGG + Intronic
1162281794 19:9704316-9704338 TATAAGGAGGCATAAGAATGTGG + Intergenic
1162711693 19:12599735-12599757 TATAAGAAGGCATGGGAATGTGG + Intronic
1162853209 19:13447828-13447850 TAAAAGCAGGCAGAAGAAGTTGG - Intronic
1163195540 19:15717166-15717188 AAAACGCAGACAGAAGAATGTGG - Intergenic
1163929225 19:20372850-20372872 TATAAGGAGGCATAAGAATGTGG + Intergenic
1164082480 19:21871654-21871676 TAAAAGCAGAAAGATGTATGTGG + Intergenic
1164130822 19:22359962-22359984 TATAAGGAGGCATAAGAATGTGG - Intergenic
1164217056 19:23160090-23160112 TATAAGGAGGCATAAGAATGTGG - Intergenic
1164499188 19:28799709-28799731 TAAAAGCAGCTAGAGGGAAGCGG + Intergenic
1164547791 19:29183596-29183618 TAAAAGCAGGCAGAGGAACGTGG - Intergenic
1164765089 19:30758538-30758560 AAAAAGCAGGCAGAAGAAGGTGG - Intergenic
1164880168 19:31726281-31726303 ATAAAGCAGGCAGAAGAAAGTGG + Intergenic
1164945395 19:32288967-32288989 TAAAAGCAGGCAGAGAGACGTGG + Intergenic
1165206543 19:34193259-34193281 TATAAGGAGGCTGAGGTATGAGG - Intronic
1165377469 19:35452932-35452954 AAAAAACAGGTAGAAGAATGTGG - Intergenic
1165460889 19:35943776-35943798 TGAAATCAGGCAGAGGATTGGGG + Intronic
1165735294 19:38172011-38172033 TAAGAGCAGCCAGGGTAATGCGG + Intronic
1166116244 19:40656756-40656778 TAACTGAAGGCAGAGGCATGTGG - Intergenic
1166900820 19:46061211-46061233 TATAAGAAGGCATGGGAATGTGG - Intronic
1167127865 19:47563448-47563470 AAAAATCAGGGAGAGGAGTGTGG + Intergenic
1167474250 19:49690999-49691021 TAAAAGGAGACGGAGGACTGGGG + Intronic
1167677355 19:50895536-50895558 TAAAAGCAGGCAGAAGAACGTGG + Intergenic
1167748327 19:51365886-51365908 TGAAAGCAGTCAGAGGAACCTGG + Intronic
1167906794 19:52667532-52667554 TATAGGGAGGCAGAAGAATGTGG + Intronic
1167935448 19:52903014-52903036 TATAAGGAGGCATAAGAATGTGG - Intergenic
1168600682 19:57715833-57715855 TATAACCAGGGAGAGAAATGGGG - Intronic
925245909 2:2382734-2382756 TAAAAGCAGGTAGAGGAACGTGG + Intergenic
925263672 2:2549348-2549370 TAAAAGCAGGCAGAGGAACGTGG - Intergenic
925343659 2:3154345-3154367 CAAAAGCAGGAAGAGGAAGCCGG - Intergenic
925390259 2:3489548-3489570 TCATAGCAGGCAGAGGACTCCGG + Intergenic
925472504 2:4177312-4177334 ATAAAGCAGGCAGAGCAATGTGG + Intergenic
925497957 2:4473214-4473236 ATAAAGCATGCAGAAGAATGTGG - Intergenic
925539343 2:4950105-4950127 TAAAATCAGGCAGAAGAACATGG - Intergenic
925540048 2:4957014-4957036 AGAAAGCAGGCAGAAGAAGGTGG - Intergenic
925541879 2:4975839-4975861 AAAAAGCAGGCAGAAGAAGGTGG + Intergenic
925704787 2:6674118-6674140 TAAAAACAGGCAGAAGAACATGG - Intergenic
925713251 2:6762040-6762062 TAAAAGCAGGCAGAGGAACGAGG + Intergenic
925720265 2:6820593-6820615 TAAAAGCAGGCAGAAGAACATGG - Intergenic
925772428 2:7296495-7296517 TAAAAGCAGGCAGAAGAACATGG - Intergenic
925806653 2:7657725-7657747 ATAAAGCAGGCAGAGGAATGTGG + Intergenic
925900219 2:8503925-8503947 ATAAAGCAGGCAGAGGAACATGG + Intergenic
926102334 2:10126289-10126311 TAAAGGGAGGCAGAGGAGGGTGG + Intronic
926117812 2:10224460-10224482 TGAAAGGAGGCAGAGGACCGGGG - Intergenic
926390465 2:12386034-12386056 AAAAAGCAGGCAGAAGAACATGG + Intergenic
926392405 2:12406713-12406735 TAAAAGCAGACAGAGGAACGTGG - Intergenic
926647221 2:15302835-15302857 ATAAAGCAGGCAGAAGAAGGTGG + Intronic
926840033 2:17070161-17070183 TAAAAGCAGGCAGAGGAACGTGG - Intergenic
926841856 2:17089732-17089754 ATAAAGCAGGCAGAGGAAGATGG - Intergenic
926905237 2:17799446-17799468 TAGAAGCAGGGACAGGAAGGAGG - Intronic
927236711 2:20881508-20881530 TAACAGCAGGCAGAGAGCTGGGG - Intergenic
927296367 2:21458652-21458674 TAAAAGCAGGCAAAGAAAAAAGG - Intergenic
928476020 2:31628847-31628869 TAAAGGCAGCCAGAGAAAAGGGG - Intergenic
928719022 2:34097821-34097843 TGAAAGCAGGCAGAGGAACGTGG - Intergenic
928809336 2:35203157-35203179 TAAAAGCAGGCAGAGGAACATGG - Intergenic
928819608 2:35343801-35343823 TGAAAGAAGGAAGAGAAATGAGG + Intergenic
928826287 2:35425418-35425440 AAAAAGCAGGCAAAAGAAGGTGG - Intergenic
929032722 2:37663876-37663898 TAAAAGCAGGCAGAGGAGGCCGG + Intronic
929032774 2:37664191-37664213 AACAAGCAGGCAGAGGAACGTGG + Intronic
929059872 2:37913295-37913317 ATAAAGCAGGCAGAAGAAGGTGG + Intergenic
929126713 2:38529234-38529256 TAAAAGTAGGCCGAGGCAGGAGG - Intergenic
929136299 2:38626949-38626971 AAAAAGCAGGCAGAAGAATGTGG - Intergenic
929270405 2:39965304-39965326 TAAAAGCAGGCAGAAGAATGTGG - Intergenic
929394446 2:41506839-41506861 AAAAAGAAGGAAGAGGGATGGGG + Intergenic
929639131 2:43558547-43558569 TAAAAGCAGGAAGAAGAACATGG + Intronic
930298233 2:49581745-49581767 TAAAAGCAGGCAGAAGAACATGG + Intergenic
930818686 2:55623930-55623952 TAGAAGGAGGCAGAGGAAGGAGG + Intergenic
930848981 2:55937541-55937563 TAAAAGCAGGCAAAGGAACATGG - Intergenic
930997377 2:57736816-57736838 TAAAAGCAGGCAGAAGATCTTGG - Intergenic
931537822 2:63298479-63298501 GAAAAGCAAGCAGAAGAAGGTGG + Intronic
931615098 2:64147766-64147788 TAAAAGCAGCCAGAGGAAAAAGG + Intergenic
931805552 2:65800355-65800377 TAAAAGCAGGCAGAAGAACGTGG + Intergenic
931931751 2:67145551-67145573 TAGAAGCAGGGAGTAGAATGGGG - Intergenic
932022307 2:68099618-68099640 TAGAACCAAGCAGAGGAAAGGGG + Intronic
932104916 2:68933432-68933454 TAAAAGCATGCTGAGGAAATGGG + Intergenic
932855387 2:75228346-75228368 ATAAAGCAGGCAGAAGAAGGTGG - Intergenic
932859081 2:75269839-75269861 TAAAAGCAGGCAGAAGCAAGTGG - Intergenic
932936197 2:76104982-76105004 AAAAAGCAAGCAGAAGGATGTGG + Intergenic
933008766 2:77029528-77029550 ATAAAGCAGGCAGAAGAAAGTGG - Intronic
933087718 2:78076795-78076817 TAAAAGCAGGCAAAAGAATGTGG - Intergenic
933265391 2:80175944-80175966 TAAAAGCAGGCAGAGGAATGTGG - Intronic
933266161 2:80182342-80182364 TAAAAGCAGGCAGAGGAATGTGG - Intronic
933311651 2:80668403-80668425 TTAAAGCAGGCAGAAGAATGTGG + Intergenic
933446250 2:82383391-82383413 TAAAACCAGGCAGAAGAACGTGG - Intergenic
933783965 2:85823609-85823631 ATAAAGCAGGCAGAAAAATGTGG - Intergenic
934073461 2:88407299-88407321 TAAAAGCAGGCAGAAGCATGTGG + Intergenic
934151199 2:89149260-89149282 AGAAAGCAGGCAGAGGAATGTGG + Intergenic
934216061 2:90032647-90032669 AGAAAGCAGGCAGAGGAATGTGG - Intergenic
934506265 2:94897184-94897206 ACAAAGCAGGCGGAGGAAGGTGG - Intergenic
934784742 2:96996759-96996781 TGAAATCAGGCAGTGGAATATGG - Intronic
935113854 2:100117033-100117055 TAAAAGCAGACAGAGGAAAAAGG - Intronic
935476988 2:103534797-103534819 TAAAAGCAGGCAGAGGCTCATGG + Intergenic
935491191 2:103722424-103722446 TAAAAGCAGCCTGAGGAACATGG + Intergenic
935574361 2:104693516-104693538 TAAAAGCAAGCAGAGTAAGAGGG + Intergenic
935637207 2:105258441-105258463 GAACAGAAGGCAGAGGAAGGAGG + Intergenic
936252305 2:110876281-110876303 GAGAGGCAGGCAGAGAAATGAGG + Intronic
936478586 2:112864243-112864265 TAAAAGGAGGCAGAAGAACAGGG - Intergenic
936731826 2:115391031-115391053 TAAAAGCAGGAGAAGGAATATGG + Intronic
936940553 2:117879651-117879673 TAAAAGCAAGCAGAAGAACATGG + Intergenic
937057349 2:118950489-118950511 TATAAGGAGGCATAAGAATGTGG - Intronic
937736201 2:125293729-125293751 ATAAAGCAAGCAGAGGAACGTGG + Intergenic
937786598 2:125906429-125906451 AAAAAGCAGGCAGAAGAAGGTGG + Intergenic
937820112 2:126300944-126300966 TAAAAGCAGGCAGAAGAATGTGG - Intergenic
937857553 2:126683418-126683440 TAAAAGCTGGCTGAGCAAGGTGG - Intronic
938080141 2:128365532-128365554 CAAAATCTGGCAGAGGAATGGGG + Intergenic
938272467 2:129986001-129986023 TAAAAGCAGGCAGAGAAATATGG + Intergenic
938344621 2:130558230-130558252 AAAAAGCAGGCAGAAGAAGGTGG - Intergenic
938345212 2:130562490-130562512 AAAAAGCAGGCAGAAGAAGGTGG + Intergenic
938683348 2:133713980-133714002 TAAAAGCAGGCAGAGGAACGTGG + Intergenic
938769426 2:134488356-134488378 ATAAAGCAGGCAGAAGAATGTGG + Intronic
939068646 2:137514322-137514344 AAAAGGCAGGCAGAAGAATGTGG + Intronic
939094118 2:137813478-137813500 TAAAAGCAGGTTGATGAATTGGG - Intergenic
939206522 2:139112247-139112269 TAAAAGTTGGAAGAGGAAAGTGG - Intergenic
939265535 2:139867794-139867816 CAAAAGCAGCCAGAGGAATGTGG + Intergenic
939341176 2:140897636-140897658 TAAAAGCAGGCAGAGGAATGTGG + Intronic
939406427 2:141764144-141764166 TAAATGAAGTCATAGGAATGGGG + Intronic
939410340 2:141816355-141816377 TAAAAGCAGGCAGAAGAAGGTGG + Intronic
939464868 2:142544355-142544377 GGGAAGCAGGCAGAGGAATAGGG - Intergenic
939756372 2:146117218-146117240 TAAAAGCAGGCAGAGGAATGTGG - Intergenic
939767356 2:146267379-146267401 TGAAAGCAGGATGAGGAAGGTGG + Intergenic
939773574 2:146356019-146356041 TAAAAGCAGTTAGAGAAAAGTGG + Intergenic
939805787 2:146774835-146774857 ATAAAGCAGGCAGAAGAAAGAGG + Intergenic
940207779 2:151223157-151223179 GAAAAGCAGGCAGAAGAAGGTGG + Intergenic
940400553 2:153243610-153243632 TATAAGAAGGCATGGGAATGTGG + Intergenic
940414965 2:153408939-153408961 AAACAGCAGGCAGAAGAAGGTGG + Intergenic
940460014 2:153952959-153952981 TAAAAGCAGGCAGAGGAACGTGG - Intronic
940473640 2:154132018-154132040 TAAAAGCAGGCAGAGAAATGTGG - Intronic
940490243 2:154350321-154350343 ATAAAGCAGGCAGAAGAACGTGG + Intronic
941043116 2:160645313-160645335 CAAAAGCAGACAGAAGAAAGGGG - Intergenic
941101801 2:161304822-161304844 TAACAGAAGGGAGAGGAAGGAGG - Intergenic
941123635 2:161560914-161560936 CAAAAGGAGGCAGAAAAATGTGG + Intronic
941283127 2:163577730-163577752 TAAAAGCAGGCAGAGGAACGTGG + Intergenic
941530699 2:166667029-166667051 TAAAAACAGGCACAACAATGAGG + Intergenic
941656729 2:168152283-168152305 TAAAAGCAGCCACAGGACAGAGG + Intronic
942258731 2:174135510-174135532 TAAAAGCAGGAGGAAGAAAGAGG + Intronic
942299384 2:174547345-174547367 TCAAAGCAGGAAGAGGGAGGAGG - Intergenic
942731910 2:179069611-179069633 AAAAATCAGGCAGAGTAAGGTGG + Intergenic
942894172 2:181031493-181031515 TAAAAACACACAGAGTAATGTGG - Intronic
943015502 2:182505375-182505397 TAACATTTGGCAGAGGAATGGGG + Intronic
943100909 2:183485023-183485045 ATAAAGCAGGGAGAAGAATGTGG + Intergenic
943156344 2:184183701-184183723 TAAAAGCAGGCAGAGGAACGTGG + Intergenic
943173223 2:184431745-184431767 TAAAGGGAAGCAGAGGAATGAGG + Intergenic
943182639 2:184562486-184562508 ATAAAGCAGGCAGAAGAAGGTGG + Intergenic
943386146 2:187205658-187205680 TAAAAGCAGGCAGAAGAACCTGG - Intergenic
943408001 2:187513069-187513091 TATAAGGAGGCATAAGAATGTGG + Intronic
943531165 2:189082868-189082890 TAAATGCAGACAGAGACATGAGG - Intronic
943831080 2:192463067-192463089 TAAAAGCAGGCAGAAGGAAGTGG + Intergenic
943832134 2:192476664-192476686 TAAAAGCAGTCAGAGGTATGTGG - Intergenic
943884986 2:193205076-193205098 TATAAGCAGGTAGAAGAATGTGG + Intergenic
943886594 2:193225674-193225696 TAAAAGCAGACAGAGGAACGTGG - Intergenic
944021535 2:195111141-195111163 TAAAAGCAGGCAGAGGAATGTGG + Intergenic
944034556 2:195278135-195278157 TAACAGCAGGCAGAGGAAAGTGG - Intergenic
944199875 2:197095227-197095249 TGAAATTAGGCAGAGGTATGTGG - Intronic
944319580 2:198322613-198322635 TAAAAGCAGGCACAGAGATATGG + Intronic
944619387 2:201498448-201498470 ACAAAGCAGACAGAGGAAGGAGG - Intronic
944769784 2:202902513-202902535 TAAAAGGAGGCAGAGGAATGTGG + Intronic
944781880 2:203027212-203027234 TAAAAGCTGACAAAGGGATGAGG - Intronic
945333048 2:208561497-208561519 TGAAAGCAGGCAGAAGAACGTGG - Intronic
945350247 2:208769145-208769167 ACAAAGAAGGTAGAGGAATGAGG + Intronic
945357136 2:208854248-208854270 TAAAAGCAGCTAGAGAAAAGGGG - Intronic
945368669 2:208989122-208989144 ATAAAGCTGGCAGAGGGATGTGG + Intergenic
945377803 2:209099560-209099582 TAAAAGCAGGCAGAGGAACATGG - Intergenic
945433312 2:209791355-209791377 AAAAAACAGGGAGAGGAATTTGG - Intronic
945554082 2:211257440-211257462 TATAAGCAAGCAGAGGCTTGAGG - Intergenic
945732179 2:213552803-213552825 TGAAAGCAGGCAGAGGAACGTGG + Intronic
946569714 2:221010335-221010357 TAAAAGCAGGCAGAAGAATGTGG + Intergenic
946588932 2:221221651-221221673 TAAATGCAGGCAGAGAAACATGG + Intergenic
946779565 2:223179017-223179039 TAAAAGAAGGCTGGGGAGTGGGG + Intronic
946790468 2:223296102-223296124 ATAAAGCAGGCAGAAGAAGGTGG + Intergenic
946901511 2:224377373-224377395 ATAGAGCAGGCAGAAGAATGTGG + Intergenic
946941853 2:224777418-224777440 TAAAAGTAGGCAGAGGAATGTGG + Intronic
946961777 2:224993064-224993086 GAAAATCAGGCAGTGGAAGGAGG + Intronic
947007077 2:225524357-225524379 TAAAAGCAGGTAGAAGAATGTGG - Intronic
947034458 2:225836267-225836289 TAAAAGCAGGCAGAGGAGCATGG - Intergenic
947057447 2:226122657-226122679 AAAAAGCAGGCAGAAGAAAGTGG - Intergenic
947206646 2:227667130-227667152 GAGAAGCAGGCAGGGGCATGGGG - Intergenic
947314984 2:228847158-228847180 ATAAAGCAGGCAGAGGAAGTTGG + Intergenic
947356340 2:229299901-229299923 AAAAAGCAAGCAGAAGAAGGTGG + Intergenic
947921051 2:233874582-233874604 ATAAAGCAGGCAGAAGAATGTGG + Intergenic
948215158 2:236223041-236223063 TGAAAGCAGGAACAGGGATGGGG - Intronic
948285313 2:236779820-236779842 ATAAAGCAGGCAGAAGAATGTGG - Intergenic
948348530 2:237319532-237319554 AAAAAGCAGGCAGAAAAACGTGG + Intergenic
948434192 2:237941891-237941913 CAAAAGCAGGCAGGGGAGTGGGG + Intergenic
948526853 2:238576075-238576097 TAAAGGGACGCAGGGGAATGGGG - Intergenic
948581433 2:238989612-238989634 ACAAAGCAGGCAGAAGAAGGGGG - Intergenic
948850580 2:240703557-240703579 GAAAAGCAGGCAGAGGGGTCAGG + Intergenic
1168822962 20:788624-788646 TATAAGAAGGCATAAGAATGTGG - Intergenic
1169041286 20:2497693-2497715 TAAAGGAAAGCAGAGAAATGGGG + Intronic
1169291565 20:4357697-4357719 AAAAAGCAGACAGAAGAACGTGG + Intergenic
1170479812 20:16754614-16754636 TAAAAACAGGCAGAGGAACATGG + Intronic
1170503845 20:17003673-17003695 TAAAAGCAGGCAGAAGAAAACGG - Intergenic
1170888821 20:20363155-20363177 TAAGAGCAGGGAGAAGAGTGGGG + Intergenic
1171052403 20:21872098-21872120 TAAAAGCAGGCAAAGGAACATGG - Intergenic
1171199284 20:23228077-23228099 ATAAAGCAGACAGAGGAATGTGG + Intergenic
1171252500 20:23659727-23659749 TAAAAGCAGGCAGAAGAATGTGG - Intergenic
1171893790 20:30742221-30742243 ACAAAGCAGTCAGAGGAAGGTGG - Intergenic
1171961542 20:31498306-31498328 CCAAAGCAGGCAGAAAAATGGGG - Intergenic
1173092768 20:39990012-39990034 TAAGAGGAGGCAGAGAAAAGAGG - Intergenic
1174094527 20:48077743-48077765 TAAAACCAGGCAGAGGAACGTGG - Intergenic
1174103513 20:48145555-48145577 TAAAAGCAGGCAGAGGAGCATGG - Intergenic
1174479036 20:50818066-50818088 TCAAAGGAGGCAGTGGAAGGGGG + Intronic
1174495557 20:50939169-50939191 ACACAGCAGGGAGAGGAATGGGG - Intronic
1174698032 20:52579978-52580000 AAAAAGCAGGCAGAGGAAAGCGG - Intergenic
1174699118 20:52590038-52590060 TAAAAGCAGGCAGAGGAACATGG + Intergenic
1174794565 20:53511275-53511297 AAAAAGCAGGCAGAAGAAGGTGG + Intergenic
1174933931 20:54846482-54846504 CAAAAGCAGGCAGGGAAATGTGG - Intergenic
1174944605 20:54971215-54971237 TCAAAGCAGGCAGAGGAACGTGG - Intergenic
1174944857 20:54973991-54974013 AAAAAGCAGGCAGAAGAAGGTGG - Intergenic
1174956119 20:55100440-55100462 AAAAAGCAGGCAGAGGAAGGTGG - Intergenic
1175029345 20:55936933-55936955 TAAAAGCAGACAGAAGAACCTGG + Intergenic
1175164691 20:57035044-57035066 TAAAATCTGGCAGAGGAATTAGG + Intergenic
1175260126 20:57668941-57668963 GTAAAGCAGGCACAGGGATGGGG - Intronic
1175698092 20:61117466-61117488 AAAAAGCAGGCAGAAGAACCTGG + Intergenic
1175758138 20:61543087-61543109 ATAAAGCAGGCAGAGGAACGTGG - Intronic
1175839276 20:62016416-62016438 ATAAAGCAGGCAGAGGAACGTGG + Intronic
1175848523 20:62073148-62073170 ATAAAGCAGGCAGAAGAAGGAGG + Intergenic
1176049899 20:63113194-63113216 TAGAATCAGGCAGAGTGATGGGG + Intergenic
1176094320 20:63333006-63333028 TAAAAGGACCCAGAGGGATGCGG - Intronic
1176276775 20:64276904-64276926 TAAAAGCAGGCAGAGGAACACGG - Intronic
1176619980 21:9049142-9049164 ACAAAGCAGGCGGAGGAAGGTGG + Intergenic
1176967226 21:15224871-15224893 TAAAAGCAGGCAGAGGTACGTGG - Intergenic
1177232451 21:18340224-18340246 TAAAAGCAGGCAGAAGAACATGG + Intronic
1177378233 21:20302120-20302142 ATAAAGCAGGCAGAAGAACGTGG + Intergenic
1177389085 21:20443324-20443346 AAAAAGCAGGGAGAGGAACGTGG + Intergenic
1177389687 21:20451573-20451595 CAAAAGCAGGCAGAAGAACGTGG + Intergenic
1177395955 21:20536511-20536533 TAAAATCAGGCAGAGGAACGTGG - Intergenic
1177478778 21:21659184-21659206 TAAAAGCAGGCAGAAGAATGTGG - Intergenic
1177533037 21:22388211-22388233 TAAAAGCAGACAGACGAACGTGG + Intergenic
1177607968 21:23406955-23406977 TCAAGGCAGGCAGATCAATGAGG - Intergenic
1177663645 21:24122841-24122863 TAAAAGCAGGCAGGGGAAAGTGG + Intergenic
1177680963 21:24370286-24370308 AAAATGCAGGCAGAAGAACGTGG + Intergenic
1177737876 21:25115715-25115737 TAAAAGCAGGCAGAGGAACATGG + Intergenic
1177940849 21:27409859-27409881 ATAAAGCAGACAGAGGAAGGTGG - Intergenic
1178011489 21:28291445-28291467 CAAAAGCTGGCAGAAGAATGTGG - Intergenic
1178053819 21:28776835-28776857 TAAAAGCAGGCAGAAGAACGTGG - Intergenic
1178121978 21:29478328-29478350 TAAAAGCAGGCAGAAGAACGTGG - Intronic
1178192404 21:30299740-30299762 AAATAGCAGGCAGAAGAAGGTGG - Intergenic
1178284256 21:31311906-31311928 TAAAAGCAGGCAGAAGAACATGG + Intronic
1178339853 21:31777091-31777113 TAAAAGCAGGCAGAAGAATGTGG + Intergenic
1178361057 21:31948762-31948784 AGAAAGCAAGCAGAGGAATGTGG + Intronic
1178435814 21:32557524-32557546 TATAAGAAGGCATGGGAATGTGG - Intergenic
1178513312 21:33225671-33225693 TAAAAACAGGCAGAAGAAGGGGG - Intergenic
1178806971 21:35847287-35847309 TAAAAGCAGGCAGAAGAACATGG + Intronic
1178836999 21:36106990-36107012 TACAAGGAGGCATAAGAATGTGG + Intergenic
1179004732 21:37503028-37503050 TAAAATCAGCCAGAGGGAAGAGG - Intronic
1179020090 21:37631970-37631992 GTAAAGCAGTCAGAGGAAAGAGG - Intronic
1179088002 21:38237527-38237549 TTACAGCAGGCTGAGAAATGTGG + Intronic
1179327718 21:40365268-40365290 TAAAAGCAGGCAGAGGAACATGG + Intronic
1179467952 21:41590303-41590325 TAAAAACAGGCAGAGGAATGTGG - Intergenic
1179626169 21:42650749-42650771 AACAAGAAGGCAGAGGAAGGAGG + Intergenic
1180050558 21:45329241-45329263 TAAAGGCAGGCAGAGGATGGGGG - Intergenic
1180218149 21:46339621-46339643 TAAAACCAGGCAGAAGAGCGTGG - Intronic
1180241521 21:46510259-46510281 ATAAAGCAGGCAGAAGAACGTGG - Intronic
1180462622 22:15580142-15580164 TAAAAGCAGGCAGAGGAATATGG - Intergenic
1180592284 22:16950860-16950882 TAAAAGCAGGCGGAGGAACATGG - Intergenic
1182243087 22:28932932-28932954 TAGAAGAAGGGAGAGGAAGGGGG - Intronic
1182431541 22:30301839-30301861 AGAAAGGAGGCAGAGGAAGGGGG + Intronic
1182853419 22:33496173-33496195 TAAAAGCAGGCAGAAGAACGTGG - Intronic
1182907608 22:33951500-33951522 TAAAAGCAGGCAGAAGAATGTGG - Intergenic
1183014918 22:34978202-34978224 TGACACCAGGCTGAGGAATGTGG - Intergenic
1183229881 22:36575156-36575178 ATTAAGCAGGAAGAGGAATGTGG + Intronic
1183860295 22:40664947-40664969 ACAAAGCAGGCAGAAGAGTGGGG + Intergenic
1183983408 22:41555725-41555747 TCACTGCAGGCAGAAGAATGGGG - Intergenic
1184334285 22:43844326-43844348 TAAAGGCAGGGAGAGGCCTGCGG + Intronic
1184665288 22:45985609-45985631 AAAAAGCAGGAAGAAGAAAGTGG + Intergenic
1184938789 22:47745348-47745370 TAAAAGCAGGCAGAGGAACATGG - Intergenic
949288807 3:2438750-2438772 TAATAGCAGGCTAAAGAATGTGG + Intronic
949570474 3:5287333-5287355 TAAAAGCAGGCCGAGCACTGTGG - Intergenic
949611055 3:5703967-5703989 TATAAGGAGGCATAAGAATGTGG - Intergenic
949629319 3:5905641-5905663 TAAAAGCATGCAGAAGAAAGTGG + Intergenic
949637265 3:5996479-5996501 ATAAAGCAGGCAGAAGAATGCGG - Intergenic
949788835 3:7770869-7770891 ATAAAGTAGGCAGAGGAACGTGG - Intergenic
949844515 3:8356327-8356349 TAAAAGCAGGCAGAAGAACATGG + Intergenic
950576090 3:13832945-13832967 GAAAGCCAGGCAGAGGAATCTGG - Intronic
950588969 3:13921672-13921694 TAAAAGCAGGCAGAGGAACATGG + Intergenic
950667926 3:14508464-14508486 GAAAAGGAGGCAGAGGACTAGGG + Intronic
950908368 3:16559938-16559960 TATAAGCAGGCAGAAGAACGTGG + Intergenic
950932111 3:16800331-16800353 TGAAAGCAGGCAGAGGGACCAGG + Intergenic
950933979 3:16820090-16820112 TAGAGGCAGGCAAAGAAATGTGG + Intronic
950988275 3:17400735-17400757 ATAAAGCAGGCAGAAGAAGGTGG + Intronic
951138202 3:19129379-19129401 TAAAAGCAAGCAGAAGGACGTGG - Intergenic
951302098 3:21010341-21010363 TAAAAGCAGGCAGAGAAATGTGG + Intergenic
951400681 3:22228779-22228801 TAAAAGCAGGCAGAAGAATGTGG + Intronic
951528997 3:23681442-23681464 AAAAAGCTGGCAGAAGAAAGTGG + Intergenic
951629336 3:24702062-24702084 CAAAAGCAGCCAGAGAAAAGTGG - Intergenic
951706123 3:25545918-25545940 TAAAACCAGGAAGGGGAATCAGG + Intronic
951858544 3:27225209-27225231 TATAAGCAGGCAGAAAAGTGTGG - Intronic
952209850 3:31219253-31219275 AAATAGCAGGCAAAAGAATGAGG + Intergenic
952294952 3:32053258-32053280 TATAAGAAGGCATGGGAATGTGG + Intronic
952344721 3:32472782-32472804 ACATAGCAGGCAGAGGAAGGTGG - Intronic
952470499 3:33645310-33645332 TAAGAGCTTTCAGAGGAATGAGG - Intronic
952642866 3:35619304-35619326 TAAAATCAGAAAGAGGAATGTGG + Intergenic
953386467 3:42509046-42509068 TTAATGGAGGCAGGGGAATGGGG - Intronic
953511650 3:43547036-43547058 TAAAAGCAGCCAGAGAAAAAAGG + Intronic
953571949 3:44078211-44078233 TAAGAACAGGCAGTGGAAGGGGG - Intergenic
953713807 3:45298257-45298279 TGGAAGCAGGCAGGGGAATGGGG + Intergenic
954498887 3:50990795-50990817 AAAAAGCAGGCAGAAGAACATGG - Intronic
954604629 3:51899491-51899513 TATAAGGAGGCATAAGAATGTGG + Intronic
954896121 3:53976467-53976489 CAAAGGCAGGCAGAGGAGTGGGG + Intergenic
955454465 3:59104340-59104362 TACAAGAAGGCATGGGAATGTGG + Intergenic
955499061 3:59566041-59566063 TAAAAGCAGGCAGAAGAACATGG + Intergenic
955811754 3:62798292-62798314 ATAAAGCAGGCAGAAGAACGTGG + Intronic
955823618 3:62922259-62922281 TTAAAGCAGGCAGAGGAATGTGG + Intergenic
955978372 3:64499467-64499489 TAAAAGCAGGCAGAGAGACATGG - Intergenic
956255885 3:67282881-67282903 TAAAAGCAGGCAGAAGAACATGG - Intergenic
956264467 3:67381397-67381419 TAAAGGCAGGGAGAGGGTTGGGG - Intronic
956632235 3:71328125-71328147 TTAAAGGAGGCAGAAGAATTTGG + Intronic
956717747 3:72093112-72093134 GAAAAACAGGGAGAGGAATGGGG - Intergenic
956722473 3:72130523-72130545 TAGAAGCAGGAATAAGAATGTGG - Intergenic
956972817 3:74546502-74546524 TAAAAGCGGGCAGAAGAATGTGG + Intergenic
956996007 3:74826902-74826924 TATAAGGAGGCATAAGAATGTGG + Intergenic
957117906 3:76050196-76050218 GAAAAGCAGGCAGAAGAACTCGG + Intronic
957123957 3:76133768-76133790 TAAAAGCAGATAGAAGAAGGTGG - Intronic
957162604 3:76629542-76629564 TAAAAGCAGGCAGAAGAACATGG - Intronic
957216815 3:77330727-77330749 TCAAGGCAGGCAAAGAAATGTGG + Intronic
957242355 3:77675222-77675244 TAAAAGCAGGCAGAGGAACATGG + Intergenic
957254540 3:77819970-77819992 TAAAAGCAGACAGAAGAAACTGG + Intergenic
957452139 3:80392984-80393006 TAAAAGCAGGCAGAGGAACGTGG - Intergenic
957453854 3:80415711-80415733 TAAAAGCAGGCAGAGGAATGTGG - Intergenic
957495846 3:80990647-80990669 ACAAAGCAGGCAGAAGAAGGTGG + Intergenic
957546176 3:81640316-81640338 TAAAAGCAGGCAGAGGAATGTGG + Intronic
957656623 3:83086644-83086666 TAAAAGCAGGAACAAGAACGTGG + Intergenic
957726128 3:84069922-84069944 TATAAGAAGGCATAGGAATATGG - Intergenic
957951424 3:87132175-87132197 ATAAAGCAGGCAGAAGAAAGTGG - Intergenic
958778132 3:98509926-98509948 AAAAAGCAAGCAGAAGAATGTGG - Intronic
958883482 3:99699413-99699435 TGAGAGCAGGAAGAGGAAGGTGG - Intronic
959010728 3:101072456-101072478 TAAGAACAGGGAGTGGAATGGGG + Intergenic
959015576 3:101130312-101130334 AACAAACAGGCAGAGGAAGGGGG + Intergenic
959071171 3:101703436-101703458 ACAAAGCAGGCAGAAGAAGGGGG + Intergenic
959163303 3:102744554-102744576 TAAACTGAGGCAGAAGAATGTGG + Intergenic
959302848 3:104624462-104624484 GAAAAGCAGGCAGAAGAAGGTGG + Intergenic
959472782 3:106773311-106773333 TAAAAGCAGGCAGAAGAACATGG + Intergenic
959649989 3:108742208-108742230 TAAAAGCAGGCAGAAGAACGTGG - Intergenic
959696788 3:109256718-109256740 TAAACGTAGGCAGAGGAACATGG - Intergenic
959868776 3:111302764-111302786 ATAAAGCAGGCAGAAGAAAGCGG - Intronic
959967871 3:112376642-112376664 ATAAAGCAGGCAGAAGAAGGTGG - Intergenic
960296527 3:115951633-115951655 TAAAAGCAGGCAGAGGAACGTGG + Intronic
960478003 3:118154292-118154314 TAAAAGCAGGCAGAGGAATGGGG - Intergenic
960654469 3:119987426-119987448 TATAAGGAGGCATAAGAATGTGG + Intronic
961030709 3:123601120-123601142 TAAAAGCAGGAGGAGGAAAGTGG + Intergenic
961256162 3:125555104-125555126 TAAAAGCTAGCAGGGGAATATGG + Intronic
961426750 3:126854447-126854469 AGAAAGGAGGCAGAAGAATGAGG + Intronic
961469822 3:127104719-127104741 GCAAAGCAGGCACAGGACTGTGG - Intergenic
961746370 3:129065952-129065974 TAAAAGCAGGCAGAAGAATATGG + Intergenic
961856998 3:129882091-129882113 TAAAAGGAGCCAGAGGAATATGG + Intronic
961961305 3:130858099-130858121 ATAAAGCAGGCAGAAGAAAGTGG - Intronic
961999863 3:131284676-131284698 TAAAAGCAGGCAGAAGAACGTGG + Intronic
962908492 3:139826372-139826394 GAATAGCAGCCTGAGGAATGGGG + Intergenic
963173773 3:142277788-142277810 TAAGAGCAGGCAGGCCAATGTGG - Intergenic
963375055 3:144454191-144454213 TCAAAGCAGGCAGAGGCATATGG + Intergenic
963460829 3:145612926-145612948 TAAAAGCAGGCAGAAGAACATGG + Intergenic
963462404 3:145633329-145633351 AAAAAGCAGGCAGAAGAAGATGG + Intergenic
963529907 3:146462226-146462248 TGAAAACAGGAAGGGGAATGAGG - Intronic
963660937 3:148128535-148128557 TTAAAGCAGGCAGAAGAACGTGG + Intergenic
963765915 3:149335881-149335903 TAAAGGAGGGCAGAGAAATGGGG + Intergenic
963893301 3:150659600-150659622 ATAAAGCAGGCAGAGGAAGGTGG - Intergenic
963929224 3:150984826-150984848 TAAAAGCAGGCAGAGGAACATGG + Intergenic
964081420 3:152763226-152763248 TAAAATGAGGAAGAGGAATATGG - Intergenic
964612802 3:158631892-158631914 TAAAAGCAAGCCGAAGAACGTGG - Intergenic
964828444 3:160856108-160856130 TAAAAGCCGGCAGAGGAACATGG - Intronic
964867976 3:161282544-161282566 ATAAAGCAGGCAGAAGAAGGTGG - Intergenic
965000623 3:162947997-162948019 GCAAAGCAGGCAGAAGAAGGTGG - Intergenic
965029111 3:163340842-163340864 TAAAAGCAGGCAGAAGAATGTGG - Intergenic
965057930 3:163745528-163745550 TAAAAGAAGACAGAAAAATGAGG - Intergenic
965126063 3:164631036-164631058 TAAAAGCAGGCAGAAGAACGTGG - Intergenic
965291443 3:166887037-166887059 TATAAGCAAGCAGAAAAATGTGG - Intergenic
965300551 3:167000855-167000877 TGAAAGAAGGAAGGGGAATGAGG - Intergenic
965359871 3:167725480-167725502 AAAAGGGAGGCAGAGGAATAGGG + Intronic
965461054 3:168963816-168963838 TAAAGGCAGGCAGAAGAATGTGG - Intergenic
965878689 3:173361040-173361062 ACAAAGCAGGCAGAAGAAGGTGG + Intergenic
966040814 3:175485666-175485688 AAAAAGCAGGAAGATGAAGGTGG - Intronic
966107225 3:176350787-176350809 TAAAAGTAGGCAGAGGAATGTGG - Intergenic
966126404 3:176581930-176581952 AATTAACAGGCAGAGGAATGAGG - Intergenic
966128158 3:176604612-176604634 GAAAAGCAGGAACATGAATGAGG + Intergenic
966262566 3:177997275-177997297 TAAAAGCAGGCAGAGGAACATGG + Intergenic
966331701 3:178821939-178821961 TTAAATCAGAGAGAGGAATGGGG - Intronic
966721377 3:183065610-183065632 TATAAGAAGGCACAGGAATGTGG + Intronic
966742209 3:183244212-183244234 AAAAAACAGGCAGAGGAAGGTGG + Intronic
966876464 3:184324869-184324891 GAATGGCAGGCAGAGGAACGAGG + Exonic
966914865 3:184579020-184579042 GAAAGGCAGGCAGAGGAGTCTGG + Intronic
967204412 3:187106584-187106606 TAAAACCAGGCAGAAGAACATGG + Intergenic
967403173 3:189086250-189086272 TAAAAGCAGGCAGAGGAATGCGG - Intronic
967648740 3:191959143-191959165 CAAGAGCAGACAGAGGAATGAGG - Intergenic
967742504 3:193018762-193018784 TAAAAGCAGGCAGAGGAACGTGG + Intergenic
967764016 3:193257795-193257817 TAAAAGCAGGCAGAGGAACGTGG + Intronic
968063497 3:195745116-195745138 ATAAAGCAGGCAGAGGAATGTGG + Intergenic
968430818 4:557365-557387 TAAAAGCAGACAGAAGAACATGG + Intergenic
968435955 4:589367-589389 TAAAAGCAGGCAGGGGAACGTGG - Intergenic
969071808 4:4545680-4545702 GAAAAGCAGGCAGAAGAACATGG - Intergenic
969082779 4:4632744-4632766 TAAAAGCAGGCAGAGTAACATGG + Intergenic
969162164 4:5270374-5270396 TAAAAGCAGGCAGAAGAACATGG - Intronic
969832860 4:9811872-9811894 TAAAACCAAGCAGAGAAAAGCGG + Intronic
969843488 4:9901005-9901027 AGGAAGCAGGCAGAGAAATGTGG - Intronic
969983824 4:11186694-11186716 TAAGAGCAGGCAGAGGAACTTGG - Intergenic
969983829 4:11186715-11186737 TAAAAGAAGGCAGAGGAACATGG + Intergenic
970052289 4:11928409-11928431 TAAAAGCAGGCACAGGAACCTGG + Intergenic
970071594 4:12165544-12165566 TAAAATCAGGCAGAGGAACACGG + Intergenic
970084655 4:12333195-12333217 TAAAAACAGGCAGAGGAGGATGG - Intergenic
970213092 4:13731257-13731279 ATAAAGCAGGCAGAAGAATGTGG + Intergenic
970233036 4:13930386-13930408 TTAGAGCAGGCAGAGGACAGAGG - Intergenic
970353339 4:15228121-15228143 GAAAAGCAGGCAGAAGAAGGTGG - Intergenic
970387735 4:15572992-15573014 GAAGAGCAGGCAGAAGAATGTGG - Intronic
970415706 4:15854820-15854842 TAAAAGCAGGCAGAAGAACGTGG - Intergenic
970547569 4:17145390-17145412 TAAAAGCAGGCAGAGAAACGTGG + Intergenic
970629074 4:17921824-17921846 TAAAAGCAGATAGCGGAATGTGG + Intronic
970629665 4:17926350-17926372 TAAAAGCAGGCAGCGGAATGTGG + Intronic
970644758 4:18107431-18107453 ACAAAGCAGGCAGAAGAAGGTGG - Intergenic
970647379 4:18138118-18138140 AAAAAGCAGGCGGAAGAAGGCGG + Intergenic
970704549 4:18784163-18784185 AAAAAGGAGGCAGAAGAACGTGG + Intergenic
970751840 4:19372792-19372814 TTAAAGCAGGCAGAAGAACGTGG + Intergenic
970773731 4:19647713-19647735 TAAAAGCAGGCAGAAGAACATGG - Intergenic
971028996 4:22616765-22616787 TAAAAGCAGGCAGAAGAAGATGG + Intergenic
971117834 4:23668548-23668570 TAAAAGCAAGAAGAGGAACTCGG - Intergenic
971126760 4:23762896-23762918 ATAAAGCAGGCAGAAGAAAGTGG + Intronic
971224941 4:24743313-24743335 CAAAGGCAGGCAGAGGAGTGAGG - Intergenic
971299359 4:25429033-25429055 CAAAGGCAAGCAGAGGAGTGGGG + Intergenic
971512347 4:27442876-27442898 TAAAAGCAGGCAGAGGAATGTGG + Intergenic
971559870 4:28064499-28064521 TAAAAGCAGGCAGAAGAACATGG + Intergenic
971826848 4:31634573-31634595 TAAAATCAGGTAAAGGAATTTGG - Intergenic
971923042 4:32968942-32968964 TAAAAGCAGGCAGAGGAATATGG + Intergenic
972039785 4:34578684-34578706 AAAAAGCAGACAGAAGAACGTGG + Intergenic
972040385 4:34588387-34588409 TAAAAACAGGCATACAAATGTGG + Intergenic
972057329 4:34819495-34819517 AAAAAGCAGGCAGAAGAAAGTGG + Intergenic
972073764 4:35057140-35057162 ATAAAGCAGGCGGAGGAACGTGG + Intergenic
972116838 4:35646652-35646674 AAAAAGCAGGCAGAAGAATGTGG - Intergenic
972121425 4:35709376-35709398 TAAAACGAGGCAGAGGAAGGTGG - Intergenic
972123937 4:35740424-35740446 TAAAAGTAGGCAGAGGAATGTGG + Intergenic
972178158 4:36433071-36433093 TAAATGTAGCCAGAGGAATGTGG - Intergenic
972274941 4:37548303-37548325 TATAAGGAGGCATAAGAATGTGG + Intronic
972431007 4:38982121-38982143 TAAAAGCAGGCAGAAGAACCTGG + Intronic
972786820 4:42334022-42334044 TAAAAGCAGGCAGAGGAACGTGG - Intergenic
972877558 4:43382179-43382201 TAAAAGCAGCAAGATAAATGAGG - Intergenic
972898298 4:43651763-43651785 TAAAAGCAGACAGAGGAACGTGG + Intergenic
972920786 4:43938810-43938832 TTAAAGTAGGCAGAAGAAAGAGG - Intergenic
972940827 4:44192821-44192843 TAAAAGGAGGCAGAAGAATACGG + Intronic
973260863 4:48161821-48161843 TAAAAGCAGGCAGAAGAACTTGG + Intronic
973268892 4:48240326-48240348 TAAAAGCAGGAAGAGAAAGGAGG + Intronic
973616392 4:52682644-52682666 TAAAAGGAGGCAGAGGAAAGTGG - Intergenic
973638649 4:52882588-52882610 TAAACGCAGGCAGAAGAACGTGG + Intronic
974179912 4:58371273-58371295 TAAAAGCAGGCAGAAGAACACGG + Intergenic
974181363 4:58387655-58387677 TAAAAGCAGGCAAAAGAATGTGG + Intergenic
974193463 4:58538506-58538528 TAAAAACAGGCAGAGGAATGTGG - Intergenic
974215128 4:58836364-58836386 TAAAAGCAGACAGAAGAATGTGG + Intergenic
974223930 4:59014072-59014094 TATAAGCAGGCAGAAAAATGTGG + Intergenic
974345789 4:60679456-60679478 TAAAAGCAGGCAGAAGAATGTGG - Intergenic
974356674 4:60821509-60821531 ATAATGCAGGCAGAGGAATGTGG + Intergenic
974474947 4:62366442-62366464 ATAAAGCAGGCAGAAGAAAGTGG + Intergenic
974818328 4:67034735-67034757 TAAAAGCAGGCAGAGAAATGTGG - Intergenic
974828107 4:67154927-67154949 TAAAAGCAGGCAGAAGAACATGG + Intergenic
974853429 4:67430614-67430636 ATAAAGCAGGCAGAAGAAGGTGG + Intergenic
974949830 4:68574646-68574668 TATAAGGAGGCATAAGAATGTGG - Intronic
975024541 4:69532182-69532204 AAAAAGCAGGTAGAGGAACGTGG + Intergenic
975343609 4:73269119-73269141 TAAAAGATGGAAGAGGAAGGCGG - Intergenic
975386416 4:73764980-73765002 TAAAAGGTGGCAGATGAATATGG - Intergenic
975681258 4:76878834-76878856 ATAAAGCAGGCAGAAGAAAGTGG + Intergenic
975928880 4:79493348-79493370 TAAAATCAGGCAGAGAAATTTGG + Intergenic
975934492 4:79562018-79562040 ATAAAGCAGGCAGAAAAATGTGG + Intergenic
976255624 4:83097798-83097820 TATAAGAAGGCATAGGAATATGG + Intronic
976759527 4:88533231-88533253 ATAAAGCAGGCAGAAGAAGGTGG - Intronic
976788794 4:88853814-88853836 TAAAAGCAGGCAGAGGAACGTGG + Intronic
976889143 4:90023716-90023738 TAAAAGGAGGCAGAAGACTTTGG - Intergenic
976961774 4:90985255-90985277 TAAAAAGAGGCAGAGAAAAGAGG - Intronic
977035112 4:91941025-91941047 TAAAAGCAGGCAGAGGAACATGG - Intergenic
977045308 4:92061824-92061846 TTAAAGCAGGCAGAAGAACATGG + Intergenic
977047779 4:92089280-92089302 TATAAGAAGGCATGGGAATGTGG - Intergenic
977270273 4:94909648-94909670 TAAAATCAGGAAGAGGGAGGAGG - Intronic
977445881 4:97131273-97131295 TAAAAGCAGGCAGAGGAACGTGG + Intergenic
977527317 4:98160897-98160919 TATAAGAAGGCATGGGAATGTGG + Intergenic
977528782 4:98175302-98175324 TAAAAGCAGGCAGAAGAATGTGG + Intergenic
977775368 4:100913399-100913421 TAAAAGCAGCCAGAAGGAAGAGG - Intergenic
977870270 4:102082346-102082368 TAAAAGCAGGCAGAAAAATGTGG - Intergenic
977912696 4:102556469-102556491 CAAAAGCAGCCAGTGAAATGGGG + Intronic
978190023 4:105899875-105899897 TATAAGCAGGTAGAGGAATGTGG + Intronic
978255350 4:106686159-106686181 AAAAAGCAGGCAGAAGAAGGTGG - Intergenic
978314068 4:107416558-107416580 TATAAGGAGGCATAAGAATGTGG + Intergenic
978950930 4:114558312-114558334 TATAAGAAGGCATGGGAATGTGG - Intergenic
978968252 4:114769368-114769390 TAAAAGCAGGCAGGGGAACGTGG + Intergenic
979083864 4:116380241-116380263 ATAAAGCAGGCAGAAGAAAGTGG + Intergenic
979160889 4:117459750-117459772 AAAAAGCAGGCAGAAGAAGGTGG - Intergenic
979217790 4:118186550-118186572 TAAAAGCAGGCAGAACAACGTGG - Intronic
979319972 4:119311751-119311773 TAAAACCAGAAAGAGGGATGTGG - Intergenic
979389727 4:120114235-120114257 TAAAAGTAGGCAGTGAAATTTGG + Intergenic
979602736 4:122604230-122604252 TCAAAGCATGCAGAAGATTGGGG - Intergenic
979670688 4:123357387-123357409 GAAAAGCAGACAGAGGAGTTTGG - Intergenic
979719378 4:123881357-123881379 TGAAAGCAAGCAGAGGAACGTGG + Intergenic
979917491 4:126454284-126454306 TAAAAGCAGGCAGAGGAATGTGG + Intergenic
979918136 4:126465193-126465215 TAAAAGTAGGCAGAGGAATATGG - Intergenic
980008005 4:127563071-127563093 TAAAACCAGGCAGAAGAACGTGG - Intergenic
980052607 4:128053405-128053427 ATAAAGCAGGCAGAAGAAAGTGG - Intergenic
980072890 4:128262444-128262466 TATAAGGAGGCATAAGAATGTGG + Intergenic
980217217 4:129867960-129867982 TAAAAGGAGGCAGAGGAACATGG + Intergenic
980255881 4:130380893-130380915 TAAAAGCAAGCAGAGGAATGTGG + Intergenic
980265668 4:130512221-130512243 ATAAAGCAGGCAGAAAAATGTGG - Intergenic
980322572 4:131297954-131297976 TAAAATCAGGCAGAGAAACATGG + Intergenic
980385497 4:132084545-132084567 CAAAAGCAGGCAGAAGAAGCTGG - Intergenic
980482699 4:133408682-133408704 TAAAAGCAGGCAGAGGAACATGG + Intergenic
980598349 4:134986692-134986714 TAAAAGCAGGCAGAAGAATATGG + Intergenic
980678709 4:136126374-136126396 GAAAAGCAGGCAGAGGAACCTGG - Intergenic
980763378 4:137266503-137266525 GAAAAGCAGGCAGAAGAACCTGG + Intergenic
980854720 4:138425318-138425340 TAAAAGCAGGCAGATGAACGTGG + Intergenic
981220342 4:142225133-142225155 AAAAAGCAGGCAGAAGAAGGTGG + Intronic
981290817 4:143072279-143072301 CAAAAGCAGGCAGAAGAAGATGG - Intergenic
981438364 4:144752937-144752959 AAAATGCAGGCAGAGGAACTAGG + Intergenic
981743893 4:148032913-148032935 ATAAAGCAGGCAGAAGAAGGTGG - Intronic
981885180 4:149665821-149665843 TAAAAGCAGGTGGAGAAAGGTGG + Intergenic
981950854 4:150405176-150405198 TAAAAGAAAGCAAAGGAATGTGG + Intronic
982108509 4:152032119-152032141 TAAAAGGAGGCAGAGGAATTTGG - Intergenic
982162543 4:152584654-152584676 ATAAAGCAGGCAGAAGAAGGTGG - Intergenic
982370065 4:154624789-154624811 TGAAAGCAGGCAGAGGAATGTGG - Intergenic
982393036 4:154886151-154886173 AAAAATCAGGCAGAAAAATGGGG - Intergenic
982597462 4:157404522-157404544 TAAAAGGAGGCAGAGGAACCTGG - Intergenic
982839290 4:160161813-160161835 TAAAAGCAGACAGAGGAATGTGG - Intergenic
983020074 4:162665357-162665379 ATAAAGCAGGCAGAGGAACATGG + Intergenic
983050727 4:163044232-163044254 TAAAAGCAGGCAGAGGAATGTGG + Intergenic
983118179 4:163846163-163846185 TAAAAGGAGGGAGAAAAATGAGG + Intronic
983151855 4:164294002-164294024 ATAAAGCAGGCAGAGGAAGGTGG + Intronic
983284930 4:165727344-165727366 TAAAAGCAGGCAGAGGAACGTGG - Intergenic
983348876 4:166561622-166561644 AAACAGCAGGCAGAAGAAGGTGG - Intergenic
983708275 4:170685151-170685173 TATAAGCAGGCATAAGAAGGTGG + Intergenic
983889146 4:173013102-173013124 TAGAAACAGACAGAGGAAGGAGG - Intronic
984432758 4:179668966-179668988 TAAAGGCAGGCAGAGGAGTGGGG + Intergenic
984436640 4:179718469-179718491 AAAAAGCAGGCAGTAGAAGGTGG - Intergenic
984452000 4:179914246-179914268 TAAAAGCAGGCAGAAGAACATGG + Intergenic
984580395 4:181503665-181503687 TAAAAGCAGGTAGAGAACTAGGG - Intergenic
984798609 4:183690664-183690686 TGAAAGAAAGCAAAGGAATGGGG + Intronic
984952079 4:185015534-185015556 CAAAATCAGGCAAATGAATGGGG - Intergenic
984985654 4:185327070-185327092 TATAAGGAGGCATAAGAATGTGG - Intronic
985076328 4:186219091-186219113 TAAAAGCAGGCAGAGGAACGTGG - Intronic
1202771198 4_GL000008v2_random:209206-209228 ATAAAGCAGGCGGAGGAAGGTGG - Intergenic
985698220 5:1354331-1354353 TAAAAGCAGGAAGAAAAAAGAGG - Intergenic
986040191 5:3986688-3986710 ATAAAGCAGGCAGAAGAAGGTGG + Intergenic
986098897 5:4587035-4587057 TAAAAACAGGCAGAGGAACGTGG + Intergenic
986133777 5:4955436-4955458 AAAAAGCAGGCAGAGGAACGTGG - Intergenic
986145328 5:5072313-5072335 TAAAAGTAGGCAGAAGAATATGG - Intergenic
986147319 5:5090726-5090748 ATAAAGCAGGCAGAAGAAGGTGG - Intergenic
986445668 5:7819116-7819138 TAAAAGCAGGCAGAAGAACGTGG - Intronic
986762977 5:10896971-10896993 ACAAAGCAGGCAGAAGAAAGTGG - Intergenic
986863298 5:11953008-11953030 CAAAGGCAGGCAGAGGAGTGGGG + Intergenic
987158382 5:15114531-15114553 TAAAAGCAGGCAGAAAAACATGG - Intergenic
987159834 5:15130961-15130983 TAAAAGCAGCCAGAGAAAAGGGG - Intergenic
987182049 5:15378257-15378279 ATAAAGCAGGCAGAAGAAGGTGG - Intergenic
987189344 5:15458286-15458308 TAAAAGCAGGCAGAAGAACGTGG + Intergenic
987197589 5:15542919-15542941 TAAAAGCAGGTTGGGGAATCAGG + Intronic
987339875 5:16930387-16930409 GAAAACCAGACTGAGGAATGTGG + Intronic
987539438 5:19235073-19235095 ATAAAGCAGGCAGAAGAATGTGG + Intergenic
987550404 5:19372706-19372728 TAAAAGCAGGCAGAGGAAAGTGG + Intergenic
987664271 5:20916297-20916319 AAAAAACAGGCAGAAGAAGGTGG - Intergenic
987700992 5:21398192-21398214 ATAAAGCAGGCAGAAGAAGGTGG + Intergenic
987731043 5:21773391-21773413 TAAAAGAAGGCAGAAGAACGCGG + Intronic
987731125 5:21774221-21774243 CAAAAGCAGGCAGAGGAACGTGG + Intronic
987774524 5:22347297-22347319 TAAAAGCAGGCAAAAGAACGTGG + Intronic
987905416 5:24069794-24069816 TGAAAGCAGGCAGAAGAACATGG - Intronic
987907394 5:24094436-24094458 CAAAAGCAGGCAGAAGAATGTGG - Intronic
987915292 5:24205076-24205098 TAAAAGCAGGCAGAGAAATGTGG + Intergenic
987920310 5:24271829-24271851 ATAAAGCAGGCAGAAGAAGGTGG - Intergenic
987994037 5:25251739-25251761 TTAAAGCAGGCAGAAGAACGTGG + Intergenic
988142274 5:27259031-27259053 GGAAAGCATGCAAAGGAATGGGG - Intergenic
988169603 5:27636649-27636671 TATAAACAGGCAGAAAAATGTGG - Intergenic
988194992 5:27993485-27993507 TAAAAGCAGGCAGAAGAACGTGG - Intergenic
988195339 5:27997711-27997733 TAAAAACAGGCAGAGGAACCTGG + Intergenic
988209367 5:28183527-28183549 ACAAAGCAGGCAGAAGAAGGTGG - Intergenic
988234260 5:28520553-28520575 TAAAAGCAAACAGAGGAATGTGG - Intergenic
988261414 5:28890972-28890994 TAAAAGCAGGCAGAACAACGTGG - Intergenic
988393744 5:30669753-30669775 TAAAAGCAGGAAGAGGAAGTTGG + Intergenic
988453102 5:31362874-31362896 TAAAAGAAGGAAGTGGAGTGAGG - Intergenic
988770494 5:34427932-34427954 AAAAAGCAGGCAGAAAAAAGTGG - Intergenic
988786145 5:34567160-34567182 TAAAAGGAGGGAGAGCAAGGAGG - Intergenic
989116515 5:37959112-37959134 TAAAAGCAGCCAGAGAAAAGAGG + Intergenic
989185263 5:38618521-38618543 TAAAAGAAGGCAGAACAAGGGGG - Intergenic
989507548 5:42244788-42244810 TAAAAGAAGGGACAGGATTGGGG - Intergenic
989756633 5:44963023-44963045 ATAAAGCAGGCAGAAGAAGGTGG - Intergenic
989757312 5:44970990-44971012 TAAAAGCAGGGAGAGGAACATGG + Intergenic
990031179 5:51261463-51261485 TAAAAGCAGGCAGAAGAATGTGG + Intergenic
990245092 5:53856680-53856702 AAAAAGCAGGCGGAAGAAGGTGG - Intergenic
990505746 5:56442950-56442972 TAAAAGCAGGCAGACAAAAATGG + Intergenic
990618729 5:57536855-57536877 TAAAAGCAGGCAGAAGAACGTGG - Intergenic
990727096 5:58768072-58768094 GAACAGCAAGAAGAGGAATGGGG + Intronic
990833846 5:59992021-59992043 TAAAAGCAGGCAGAGAAACATGG + Intronic
990857603 5:60287570-60287592 GAAAAGGAGGCAGAGGATTCTGG - Intronic
990921597 5:60974172-60974194 TTAAAGCAGGCAGAAGAAAGTGG + Intronic
990931090 5:61093149-61093171 ATAAAGCAGGCAGAAGAAAGCGG - Intronic
990958917 5:61372576-61372598 AAAAAGCGGGAAGAGGAAGGTGG - Intronic
991034026 5:62109659-62109681 TAAAAGCAGGCAGAGGAACATGG + Intergenic
991192848 5:63896221-63896243 TAAAAGCAGGCAGAGGAACATGG + Intergenic
991218214 5:64181130-64181152 ACAAAGCAGGCAGAAGAACGTGG - Intronic
991293895 5:65060955-65060977 TGGGAGCAGGGAGAGGAATGAGG + Intergenic
991330429 5:65487154-65487176 TAAAAGCAGGCAGAAGAACATGG - Intergenic
991385848 5:66088477-66088499 TAAAAGCAGCCAGAGGAAAAAGG + Intergenic
991579483 5:68139383-68139405 TAAAAGCAGGCAGAAGAACATGG - Intergenic
991596934 5:68315805-68315827 TCAAAGCAGGCACAGGGCTGGGG + Intergenic
991661764 5:68957883-68957905 CAAAAGCTGGCAAAGAAATGAGG + Intergenic
992015700 5:72573250-72573272 TAAAAGCAGGCAGAAGAAATTGG + Intergenic
992242452 5:74786051-74786073 AAAAAGCAGGCAGAAGAACGTGG + Intronic
992243283 5:74792383-74792405 AAAAAGCAGGCAGAAGAACATGG + Intronic
992319712 5:75601561-75601583 TAAAAGCAGGCAGAGGAAGGTGG + Intergenic
992641890 5:78774857-78774879 TAAAAGCAGGGAGAGGAACATGG + Intergenic
992768033 5:80020650-80020672 TAGCAGCAGGCAGCTGAATGAGG + Intronic
992846076 5:80749412-80749434 TAAAAGCAGGCAGAGAAACATGG - Intronic
993203712 5:84850085-84850107 TAAAAGCAAGCAGAAGAACGTGG + Intergenic
993229363 5:85211992-85212014 TAAAAGCAGGCAGAAGAACGTGG + Intergenic
993422299 5:87717680-87717702 TATAAGAAGGCACGGGAATGTGG - Intergenic
993442150 5:87970430-87970452 GAAATGCAGGCAGAGTAATAAGG + Intergenic
993461471 5:88188594-88188616 ATAAAGCAGGCAGAAGAAAGTGG + Intergenic
993694707 5:91047526-91047548 TAAAAGCAGGCAGAAGAACATGG - Intronic
994018346 5:94994801-94994823 TAAAAGCAGGCAGAAGAATGTGG + Intronic
994051875 5:95371139-95371161 TAAAAGCAGGCAGAATAACGTGG + Intergenic
994269471 5:97760057-97760079 AAAAAGCAGGCAGAAGAACGTGG - Intergenic
994379864 5:99058094-99058116 TAAAAGCAAGCCAAGGAAAGGGG - Intergenic
994588849 5:101748358-101748380 CAAAAGCAAGCAGAAGAAAGTGG + Intergenic
994613959 5:102079811-102079833 TAAAAGCAGCTAGAGAAAAGGGG + Intergenic
995107670 5:108393422-108393444 ATAAAGCAGGCAGAAGAAAGTGG - Intergenic
995154396 5:108893555-108893577 CAGAAGCAGGCATAGTAATGAGG + Intronic
995197247 5:109385215-109385237 GAATAGCATGAAGAGGAATGAGG + Intronic
995287926 5:110413178-110413200 AAAAAGCAGGCAGAGGAACATGG + Intronic
995291586 5:110462454-110462476 TAAAAGCAGGCAGAGGAACATGG + Intronic
995348066 5:111143597-111143619 TAAAAGTAGGGAGACCAATGAGG + Intergenic
995349834 5:111162417-111162439 TAAAAGCAGGCAGAAGAACATGG - Intergenic
995367642 5:111381533-111381555 TAAAAGCAGGCAGAAGAACGTGG - Intronic
995866701 5:116698868-116698890 TAAAGGAAGGCAGAGAAATAAGG + Intergenic
995867334 5:116705493-116705515 TATAAGGAGGCATAAGAATGTGG + Intergenic
996018881 5:118570407-118570429 TAAAAGCAGGCAGAATAATGCGG + Intergenic
996101075 5:119446386-119446408 TATAAGGAGGCATAAGAATGTGG + Intergenic
996110943 5:119565770-119565792 TAAAAGCAGACAGAAGAATGTGG - Intronic
996266139 5:121543064-121543086 TAAAAGCAGGCAGAAGAACGTGG + Intergenic
996322554 5:122235358-122235380 AAAAAGCAGGCAGAAGAATGTGG - Intergenic
996628070 5:125594339-125594361 AAAAAGCAGGAAGACAAATGTGG + Intergenic
996657612 5:125960287-125960309 AGAAAGCAGGCAGAAGAAGGTGG - Intergenic
996761942 5:126994997-126995019 ATAAAGCAGGCAGAAGAAGGTGG - Intronic
997749742 5:136332498-136332520 CAAAAGCAGGAAGAGCAATTAGG + Intronic
998260449 5:140627078-140627100 TATAAGAAGGCACAGGAATGTGG - Intergenic
998290013 5:140906019-140906041 TAAAAGCAGACAGAAGAACGTGG - Intronic
998290789 5:140912135-140912157 TAAAAACAGGCAGAAGAACATGG - Intronic
998552592 5:143091929-143091951 TATAAGGAGGCATAAGAATGTGG - Intronic
998612897 5:143708676-143708698 TAAGAGAAGGCAGAGGTATTAGG - Intergenic
998701337 5:144703311-144703333 TAAAAGCAGGCAGAGTAACGTGG + Intergenic
998737143 5:145155135-145155157 AAAAAGCAGGCAGAAGAAGGTGG + Intergenic
998917732 5:147034105-147034127 TAAAAGAAAGCAGAGCAGTGTGG - Intronic
999351694 5:150877339-150877361 TTAAAGCAGGCAGAAGAACGTGG + Intronic
1000448181 5:161350733-161350755 TAAAAGCAGGCAGAGGAACATGG + Intronic
1000469374 5:161621530-161621552 TAAAACCAGGCAGAGAAACATGG - Intronic
1000604341 5:163312302-163312324 TAAAAGCAGGCAGAAGAACATGG + Intergenic
1001173839 5:169446473-169446495 ATAAAGCAGGCAGAAGAAAGTGG + Intergenic
1002463701 5:179391017-179391039 TGAAAGCAGGCAGAGCAAAATGG + Intergenic
1002561612 5:180086147-180086169 CAGAAGCAGCCAGAGAAATGGGG - Intergenic
1002645995 5:180655194-180655216 ACAAAGCAGGCAGAAGAACGTGG + Intergenic
1003345781 6:5265236-5265258 TAAAAGCCAGATGAGGAATGTGG + Intronic
1003673619 6:8182370-8182392 CAGAGGCAGGCAGAGGAGTGGGG + Intergenic
1003702231 6:8480052-8480074 TAAAAGCAGGCAGAGAAAAAAGG - Intergenic
1003732692 6:8843651-8843673 TAAAAGCAGGCAGAAGAATGTGG + Intergenic
1004021601 6:11780807-11780829 ATAAAGCAGGCAGAGGAACGTGG + Intronic
1004039401 6:11960901-11960923 CAAAGGCAGTCAGAGGAGTGGGG - Intergenic
1004502027 6:16217791-16217813 TAAAAGCAGGCTGCGCAAGGTGG - Intergenic
1004505841 6:16246044-16246066 TAAGAGCAGGCTGAGGATGGTGG + Intronic
1004587924 6:17020723-17020745 TAAATACAGGCAGAGTAATGAGG - Intergenic
1004681832 6:17903626-17903648 TGAATGCAGGCACAGGGATGGGG + Intronic
1004708021 6:18142540-18142562 CAAAGGCAGGCAGAGGAGTGGGG - Intronic
1004774475 6:18827467-18827489 TAACAGATGGCTGAGGAATGAGG + Intergenic
1004777594 6:18865534-18865556 TAAAACCAGAAAGAGGACTGGGG + Intergenic
1004804308 6:19185432-19185454 TAAAAGCAACCAGAGAAATGTGG + Intergenic
1005142194 6:22645811-22645833 TAATAGCAGAGAGAGGAATCTGG - Intergenic
1005243722 6:23858381-23858403 TAAAAGAAGACAGAGGCAAGAGG + Intergenic
1005754314 6:28911874-28911896 AAAAGGCAGGCAGAGGAAAATGG + Intronic
1006032179 6:31184886-31184908 TATAAGGAGGCATAAGAATGTGG - Intergenic
1006138888 6:31915050-31915072 TAAAAGCAAGCACAGAAATGAGG - Intronic
1006326093 6:33355140-33355162 TATAAGGAGGCATAAGAATGTGG - Intergenic
1006570640 6:35000785-35000807 TATAAGGAGGCATAAGAATGTGG + Intronic
1008168147 6:48166489-48166511 TGAAAGCAGGCAGAGGAACGTGG - Intergenic
1008214053 6:48763308-48763330 AAGAAGCAGGCTAAGGAATGTGG + Intergenic
1008340187 6:50354999-50355021 TAAAAGCAAGAAGAGAAATGTGG + Intergenic
1008483516 6:52010835-52010857 TAAGAGCAGGAAGAGGGAAGGGG - Intronic
1008688608 6:53952040-53952062 TTAAGGCAGACAGAGGAATTCGG - Intronic
1009635666 6:66261486-66261508 TATAAGGAGGCATAAGAATGTGG + Intergenic
1009660501 6:66605469-66605491 TAAAAGCAAACAGAGGAAAGTGG - Intergenic
1009660770 6:66607531-66607553 TAAAAGCAGGCAGAGGAAAATGG - Intergenic
1009816159 6:68738432-68738454 TAGAAGCAGGGAGATGAATTAGG + Intronic
1009850543 6:69192356-69192378 TAAAAGCAGGCAGAAGAATGGGG - Intronic
1009881419 6:69571042-69571064 TAAAAGCAGACAGAAGAATGTGG + Intergenic
1009970168 6:70616923-70616945 TAAAAGCAGGCAGAAGAACATGG + Intergenic
1010317755 6:74470158-74470180 TATAAGGAGGCATAAGAATGTGG + Intergenic
1010325937 6:74561939-74561961 GAAAAGCAGGCAGAGGAACATGG + Intergenic
1010448952 6:75980541-75980563 ATAAAGCAGGCAGAAGAAGGTGG + Intronic
1010497047 6:76546773-76546795 AAAAAGCAGGCAGAAGAACGTGG + Intergenic
1010629442 6:78179996-78180018 TAAAAGTAGGCAGAGGAACCTGG - Intergenic
1010705267 6:79101310-79101332 TAAAAGCAGGCAGAGGAATGTGG - Intergenic
1010810793 6:80296887-80296909 TATAAGAAGGCAGGGGAATGAGG - Intronic
1010842019 6:80657703-80657725 TAAAAGCAGGCAGACGAACGTGG - Intergenic
1011026323 6:82873317-82873339 GAAAAGCAGGCAGAGGAACGTGG + Intergenic
1011153966 6:84308281-84308303 TAACAGCAGCCTAAGGAATGTGG - Intergenic
1011186574 6:84683413-84683435 TAACAGCAAGCAGAGGAACGTGG + Intergenic
1011328007 6:86172364-86172386 ATAAAGCAGGCAGAGGAATGTGG + Intergenic
1011564359 6:88658728-88658750 TAAAAGCAGGCAGAGGAACATGG + Intronic
1011570270 6:88727279-88727301 TATAAGTAGGCATAAGAATGTGG + Intronic
1011807859 6:91093158-91093180 TAAAGGCAGTCAGAGAAATTAGG + Intergenic
1011830363 6:91364450-91364472 AAAAAGCAGGCAGAAGAAGGTGG + Intergenic
1011954023 6:93002655-93002677 CAAAAGCAGGCAGGAGAACGTGG + Intergenic
1012071805 6:94629960-94629982 TAAAAGCAGGCAAAAGAACGTGG + Intergenic
1012420153 6:99056119-99056141 TAAAAGCAGGCAGAAGAACATGG + Intergenic
1012571260 6:100732384-100732406 GAAAGGCAGACAGAGGAAAGGGG + Intronic
1012577401 6:100819704-100819726 ATAAAGCAGGCAGAAGAATATGG - Intronic
1012736867 6:102959065-102959087 TAAAAGCAGGCAGAAGAACATGG + Intergenic
1012870535 6:104668021-104668043 TCAAAGCAAGCAGAGGAACATGG + Intergenic
1012987759 6:105893138-105893160 TCAAAGCAGACAGAGGGAGGGGG + Intergenic
1012998365 6:105995117-105995139 TAAAAGAAGGCAAGGGAATGGGG - Intergenic
1013175839 6:107675700-107675722 TGAAAGCAGAGAGAGGCATGTGG - Intergenic
1013612183 6:111805863-111805885 AAAAAGTAGGCAGAGGGGTGGGG + Intronic
1013788165 6:113806401-113806423 GAAAAACAGGCAGAGAAGTGGGG - Intergenic
1013823178 6:114180001-114180023 AAAAAGCAGGCAGAAGAAGGTGG - Intronic
1013847722 6:114474358-114474380 TGAAAGCTGTCAGAGGAAAGAGG + Intergenic
1013887498 6:114987990-114988012 AAAAAGCAGGCAGAGGAAGGTGG + Intergenic
1013888466 6:114999161-114999183 TAGAAGCAGTCAGAGGTATAGGG + Intergenic
1013935673 6:115590031-115590053 TAAAAGCAGACAAAGGAACGTGG - Intergenic
1014113978 6:117652098-117652120 ATAAAGCAGGCAGAGGAAAGTGG - Intergenic
1014160093 6:118157732-118157754 TAAAAGCAGGCAGAGTAACGTGG - Intronic
1014200527 6:118604471-118604493 TATAAGAAGGCACGGGAATGTGG - Intronic
1014334792 6:120119955-120119977 TAAAAGCAGGCAGAGGGACGTGG + Intergenic
1014415015 6:121173161-121173183 TAAAAGCAGGTAGAAGAGCGTGG + Intronic
1014433705 6:121398718-121398740 TAAAAGCAGGCAGAAGAACATGG - Intergenic
1014530183 6:122549454-122549476 TAAAGAATGGCAGAGGAATGTGG - Intronic
1014581024 6:123137463-123137485 TAAAAGCAGACAGAGGAACATGG + Intergenic
1014728477 6:125002598-125002620 TAAAAGCAAGAAGAGGAAAACGG - Intronic
1015022076 6:128488262-128488284 ATAAAGCAGGCAGAAGAAAGTGG - Intronic
1015095123 6:129407070-129407092 TAAAAGCAGGCAGAAGAAAGTGG - Intronic
1015110869 6:129590042-129590064 TAAAAGCAGGCAGAAGAAAGTGG - Intronic
1015138218 6:129898488-129898510 TAAGCACAGGCAGAGGAATTTGG + Intergenic
1015218141 6:130773658-130773680 TAAAAGCAGGCAGAGGAATGTGG + Intergenic
1015423038 6:133033366-133033388 TAGAAGCAGGCAGATGACAGAGG + Intergenic
1015516278 6:134085728-134085750 TAAAAGCAGGCAGAAGAACATGG + Intergenic
1015649824 6:135444241-135444263 TTAATGCAGGCAGTGGCATGGGG - Intronic
1015726365 6:136303480-136303502 AAAAAGCAGGCAGAAGAAGGTGG + Intergenic
1015742402 6:136470623-136470645 TGAAAGCAAGCAGAGGAGGGTGG - Intronic
1016108576 6:140192520-140192542 TACAAGAAGGCATGGGAATGTGG + Intergenic
1016144739 6:140655894-140655916 TAAAAGCAGGCGGAAGAACGTGG + Intergenic
1016224252 6:141715456-141715478 AAAAAGCAGGCAGAAGAAGGTGG - Intergenic
1016235183 6:141855634-141855656 TAAAAACAGGCAGATGAACATGG - Intergenic
1016439723 6:144070489-144070511 TAAAAGCAGGCAGAAGAACGTGG + Intergenic
1016560176 6:145387849-145387871 TACAAGCAGGCAGAGGAGCAGGG + Intergenic
1016591535 6:145750580-145750602 TAAAAGCAGGCAGAGGAACATGG + Intergenic
1016657589 6:146539731-146539753 TTAAAGCAGGCAGAGGAATGTGG - Intergenic
1016683321 6:146854976-146854998 TAAAAGCAGACAGAGGAACGCGG + Intergenic
1016769082 6:147828519-147828541 TAAAAGCAGGCAGAAGAACGTGG + Intergenic
1016849500 6:148602361-148602383 TCAAGGCAGGCAGAGGAGTGGGG - Intergenic
1016856560 6:148676597-148676619 TAAAAGCAGGCAGAAGAACGTGG - Intergenic
1016857846 6:148689026-148689048 TAAAAGCAGGAAGAAGAACATGG + Intergenic
1016859901 6:148707151-148707173 ATAAAGCAGGTAGAAGAATGTGG - Intergenic
1017221697 6:151972979-151973001 TAAAAGCAGGCAGAAGAACATGG - Intronic
1017227433 6:152038236-152038258 TAAAAGCAGGCAGAGGAACGTGG - Intronic
1017228282 6:152044733-152044755 CAAAAACAGGCAGAGGAACATGG - Intronic
1017293339 6:152766253-152766275 TAAAAGCAGGCAGAGGAATGTGG - Intergenic
1017330526 6:153193202-153193224 GTAAAGCAGGCAGAAGAAGGTGG + Intergenic
1017356323 6:153513500-153513522 AAAAAGCAGGCAGAAGAAGGTGG - Intergenic
1017357634 6:153528432-153528454 TAAAAGCTGGCAGAAGAAGGTGG - Intergenic
1017379884 6:153815620-153815642 TAAAATCAGGCAGAGGAACTTGG - Intergenic
1017424411 6:154305744-154305766 ATAAAGCAGGCAGAAGAAGGTGG + Intronic
1017564339 6:155667998-155668020 TAAAAGCAGGTAGAGGAATGTGG + Intergenic
1017584146 6:155901686-155901708 TAAAAGCAGGGAGAAGAACGTGG + Intergenic
1017857117 6:158359568-158359590 AAAAAGCAGGCAGAAGAACGTGG - Intronic
1017934192 6:158989974-158989996 TATAAGCAGGCAGAAAAATGTGG + Intronic
1017952578 6:159148699-159148721 ATAAAGCAGGCAGAAGAACGTGG + Intergenic
1018082712 6:160272140-160272162 CATAGGCAGGCAGAGGAGTGGGG + Intronic
1018208321 6:161456252-161456274 TAAAAGCAGGCAGAAGGGTGTGG + Intronic
1018224395 6:161614148-161614170 TAAAAGCAACCAGAGAGATGTGG - Intronic
1018254762 6:161906910-161906932 TAAAAGCAGGCAGAAGAGCGTGG - Intronic
1018399448 6:163407475-163407497 TAAAAGCAGGCAGGGCACAGTGG - Intergenic
1018466703 6:164053464-164053486 ACAAAGCAGGCAGAAGAACGTGG + Intergenic
1018479069 6:164171869-164171891 TAAAAGCAGGCAGAAGAACATGG + Intergenic
1018486237 6:164243649-164243671 TAAAAACAGGCAGAAGAACGTGG + Intergenic
1018530712 6:164759921-164759943 AAAAAGCAGGCAGAAGAAGGTGG + Intergenic
1018536997 6:164831299-164831321 AAAAAGCAGACAGAAGAAAGTGG + Intergenic
1018564016 6:165132549-165132571 AAAAAGCAGGCAGAAGAACATGG - Intergenic
1018654456 6:166020590-166020612 ACAAAGCAGGCAGAAGAAGGTGG + Intergenic
1019003144 6:168772309-168772331 ATAAAGCAGGCAGAAGAAGGTGG + Intergenic
1019020264 6:168912118-168912140 TAAAAGCAGGCAGAGGAACGTGG + Intergenic
1019093996 6:169564265-169564287 TAAAAGCAGGCAGAGGAACGTGG - Intronic
1019140987 6:169942633-169942655 AAAAAGCAGGTAGAGAGATGAGG + Intergenic
1019256042 7:51868-51890 TAAAAGCAGGCAGAGAAATGCGG - Intergenic
1019947489 7:4341628-4341650 TAAAAGCAGGTAGAGGAATGTGG - Intergenic
1019954546 7:4402933-4402955 TAAAAGCAGGTAGAGGAATGTGG - Intergenic
1020043985 7:5026385-5026407 TATAAGGAGGCATAAGAATGTGG - Intronic
1020329442 7:7002789-7002811 ACAAAGCAGGCGGAGGAAGGTGG - Intergenic
1020501032 7:8920635-8920657 TAAAAGCAGGCAGAAGAACGTGG - Intergenic
1020631646 7:10648094-10648116 CAAAAGAAGGCACAGGAATAAGG - Intergenic
1020886281 7:13822589-13822611 TAAAAGCAGGCAGAAGAACGTGG + Intergenic
1020890207 7:13869018-13869040 TAAAAGCAGGCAGAAGAACATGG - Intergenic
1020978151 7:15033410-15033432 TAAAAGCAGGCAGAAGAACATGG + Intergenic
1021094231 7:16517042-16517064 TAAAAGTGGGCAGAGGGATAAGG - Intronic
1021471925 7:21012996-21013018 TAAAAGCTGCCAGAGTAATTGGG + Intergenic
1021527700 7:21607275-21607297 TAAAAGCAGACAGAGGAATGTGG - Intronic
1021569018 7:22045579-22045601 TAAAAGCAGGCAGAAGAACATGG + Intergenic
1021783370 7:24129012-24129034 TTAAAGCAGGGACAGGCATGGGG - Intergenic
1022000837 7:26224635-26224657 TAAAAGCAGAGAGTAGAATGGGG + Intergenic
1022405748 7:30088431-30088453 TAAAATCAGGCTTAGGAATGTGG + Intronic
1022418471 7:30198239-30198261 TAGAAGAGGGGAGAGGAATGGGG + Intergenic
1022421125 7:30224459-30224481 TTAAAGAAGGAAGAGAAATGTGG + Intergenic
1022511947 7:30941478-30941500 GAAAAGAAGGCAGAGGAGGGAGG - Intronic
1022866629 7:34428408-34428430 TAAAACCAGGCAAAGGAATGTGG + Intergenic
1023145823 7:37150010-37150032 TACTAGCTGGCAGGGGAATGGGG - Intronic
1023157459 7:37265451-37265473 AAAATGCAAGCAGAGAAATGAGG - Intronic
1023198950 7:37672744-37672766 TAAAAGCAGACAGAAGAACATGG + Intergenic
1023374755 7:39544925-39544947 TAAAAGCAGGCAGGGGAACATGG - Intergenic
1023463696 7:40429636-40429658 TAAAAGCAGGCAGAAGAATATGG - Intronic
1023565332 7:41518622-41518644 TAAAAGCAGGCAGAGGAACAAGG - Intergenic
1023790913 7:43752936-43752958 TGAAAGCAGGCAGAGGAACATGG + Intergenic
1023799395 7:43820597-43820619 TATAAGGAGGCATAAGAATGTGG + Intergenic
1023942539 7:44779129-44779151 ATAAAGCAGGCAGAAGAAGGTGG - Intergenic
1024205485 7:47156066-47156088 CTAAAGCAGGCAGAAGAAGGTGG - Intergenic
1024468285 7:49737932-49737954 ATAAAGCAGGCAGAAGAAGGTGG + Intergenic
1024993413 7:55253834-55253856 TAACAGCAGGCAGACAAACGTGG + Intronic
1025086988 7:56031266-56031288 TACAAGAAGGCAGGGGAAGGAGG + Intronic
1025094567 7:56087410-56087432 TGGATGCAGGCAGGGGAATGGGG - Intronic
1026072199 7:67131929-67131951 TAAAAGCAGGCAGAAGAACGTGG - Intronic
1026134503 7:67647444-67647466 TACAAGCAGGCAGAGGAACGTGG - Intergenic
1026176623 7:68003229-68003251 TAAAAGCAGGCAGAATTATGTGG - Intergenic
1026181234 7:68042701-68042723 ACAAAGCAGGCAGAAGAATATGG + Intergenic
1026242621 7:68590143-68590165 TAAAAGCAGGCAGAGGAATGTGG - Intergenic
1026261683 7:68760986-68761008 TAAAAACAGGCAGAAGAATGTGG - Intergenic
1026512548 7:71038966-71038988 TAAAAGCAGGAAGAGGAACGTGG - Intergenic
1026704701 7:72680337-72680359 TAAAAGCAGGCAGAAGAACATGG + Intronic
1026995189 7:74611291-74611313 TAAAAGCAGGCTGAGCACAGAGG - Intergenic
1027129873 7:75583164-75583186 CAAAGGCAGGCAGAGAGATGGGG - Intronic
1027288079 7:76671428-76671450 GAAAAACAAGCAGAGGACTGTGG - Intergenic
1027548395 7:79559160-79559182 TAAAATCAGGCAGAGTACGGAGG - Intergenic
1027580438 7:79988038-79988060 TAAAAGCAGGCAGAAGAATGTGG + Intergenic
1027686132 7:81280509-81280531 AAAAAGGAGGCAGAAGAAGGTGG + Intergenic
1027692755 7:81368986-81369008 ATAAAGCAGGCAGAAGAAGGTGG + Intergenic
1027929257 7:84510092-84510114 TAAAATCAGGCAGAGGAAAGTGG + Intergenic
1027994355 7:85405595-85405617 TACAAGCAGGCAGAGAAACATGG + Intergenic
1028043422 7:86087919-86087941 AAAAAGCAGGCAGAGGAACTTGG + Intergenic
1028044145 7:86094028-86094050 AAAAAGCAGGCAGAGGAACATGG + Intergenic
1028256234 7:88601309-88601331 TATAAGGAGGGAGAGGAAGGCGG - Intergenic
1028482324 7:91321243-91321265 TAGATGAAGGCAGGGGAATGGGG - Intergenic
1028516368 7:91681799-91681821 CAAAAGAAGGCAGAAAAATGTGG - Intergenic
1028521800 7:91740542-91740564 TAAAAGCAGGAAGAGAACAGAGG - Intronic
1028651549 7:93155795-93155817 TAAAAGCAAGAAGAGAAAGGAGG + Intergenic
1029058987 7:97777524-97777546 TGACAGCAGGCAGTGGGATGGGG + Intergenic
1029171849 7:98636076-98636098 TAAAAGCAGGCAGAAGAACGTGG + Intergenic
1029191169 7:98773307-98773329 AAATTGCAGGCAGAGGAACGTGG - Intergenic
1029690047 7:102175298-102175320 TAAAACCAGCCAAGGGAATGTGG - Intronic
1030037700 7:105422062-105422084 AAAAAGCAGGCAGAAGAAGGTGG - Intergenic
1030141176 7:106305409-106305431 TAAAAGTTGCCAGAGGAAAGAGG + Intergenic
1030159142 7:106489603-106489625 TACATGCAGGCAGAGGCATTGGG - Intergenic
1030696729 7:112593091-112593113 TAAAAGCAGACAGAGGATTGTGG + Intergenic
1030791121 7:113730204-113730226 AAAAAGCAGGCAGAAGAATGTGG + Intergenic
1030806033 7:113920395-113920417 TTAAAGATGGCAGAGGAATGGGG + Intronic
1030882792 7:114901998-114902020 TAAAAGCAGACAGAGGAATGTGG - Intergenic
1031102449 7:117498787-117498809 TGAAGACAGGCAGAGGAAAGAGG - Intronic
1031144136 7:117979139-117979161 TGAAAGCAGGCAGAGGAACGTGG - Intergenic
1031185486 7:118474617-118474639 ATAAAGCAGGCAGAAGAATGTGG - Intergenic
1031236391 7:119184336-119184358 TAAATGCAGAAAGAAGAATGTGG + Intergenic
1031239621 7:119220419-119220441 ATACAGCAGGCAGAAGAATGTGG - Intergenic
1031312444 7:120215687-120215709 ATAAAGCAGGCAGAAGAACGTGG + Intergenic
1031338976 7:120575418-120575440 TAAAAGCAAGCATAGGAACGTGG - Intronic
1031643435 7:124193613-124193635 AATAAGCAGGCAGAAGAACGTGG - Intergenic
1031768257 7:125808056-125808078 TAAAAGCAGTCAGAGGAACGTGG - Intergenic
1031882349 7:127211393-127211415 ATAAAGCAGGCAGAAGAATGCGG - Intronic
1032170452 7:129580017-129580039 TATAAGGAGGCATAAGAATGTGG + Intergenic
1032317938 7:130857376-130857398 TAAAAGCAGCAAGAGAAAAGAGG + Intergenic
1032492205 7:132332130-132332152 TACAAGAAGGCAGAGGAAAGAGG - Intronic
1032527506 7:132590631-132590653 ATAAAGCAGGCAGAAGAACGTGG - Intronic
1032535108 7:132656653-132656675 AGAAAGCAGGCAGAAGAAGGTGG + Intronic
1032634637 7:133693358-133693380 ATAAAGCAGGCAGAGGAAGGTGG - Intronic
1032671681 7:134089290-134089312 TATAAGAAGTCATAGGAATGTGG - Intergenic
1032672333 7:134096757-134096779 ATAAAGCAGGCAGAAGAACGTGG - Intergenic
1032729766 7:134628571-134628593 TAAAAGCAGGCAGAAAAAAGAGG - Intergenic
1032890604 7:136191116-136191138 ATAAAGCAGGCAGAAGAATGTGG - Intergenic
1032979568 7:137266323-137266345 TATAAGGAGGCATAAGAATGTGG - Intronic
1033070427 7:138196877-138196899 TAAAAGCAGGCAGAAGAATGTGG + Intergenic
1033403633 7:141051016-141051038 AAAAAGCAGGCAGAAGAAGGTGG - Intergenic
1033487946 7:141809944-141809966 AAAAAGCAGGCAGAAGAAGGTGG - Intergenic
1033501128 7:141950791-141950813 TAAAAGCAGGCAGAGGAACATGG + Intronic
1033575505 7:142679909-142679931 TAAAAGCAGACAGAAGAATGTGG + Intergenic
1033712591 7:143963808-143963830 TAAAAGCAGGCAGAGGAACATGG - Intergenic
1033856387 7:145566345-145566367 TATAAAAAGGCATAGGAATGTGG - Intergenic
1033957537 7:146869781-146869803 AAAAAGCAGGCAGAAGACGGTGG - Intronic
1034037441 7:147839136-147839158 TAAAAGCAGGCAGAAGAACGTGG - Intronic
1034076915 7:148240902-148240924 TAAAAGCAGGTAGGGGAACGTGG - Intronic
1034250151 7:149683619-149683641 TATAATAAGGCATAGGAATGTGG - Intergenic
1034587843 7:152111567-152111589 TAAAAGATGGGAGAGGAGTGAGG - Intronic
1034747442 7:153535637-153535659 TAAAAGCAGGCAGAGGAACACGG + Intergenic
1034783506 7:153903885-153903907 CAGAAGCAGGAAGAGGACTGAGG + Intronic
1035673273 8:1436389-1436411 TAAAAGCAGGCAGAGGAAGGTGG - Intergenic
1035777152 8:2196790-2196812 TAGAAGCAGGCAGAGGAAGGTGG - Intergenic
1035780993 8:2228467-2228489 AAAAAGCAGGCAGAAGAAGGTGG + Intergenic
1036076732 8:5510784-5510806 TTTAAACAGGCAGAGGAGTGTGG - Intergenic
1036131906 8:6123292-6123314 AAAAAGCAGGCAGAAGAAGGTGG - Intergenic
1036215192 8:6873678-6873700 GGAAAGGAGGCAGAGGAGTGTGG + Intronic
1036491386 8:9229278-9229300 ATAAAGCAGGCAGAAGAAGGTGG - Intergenic
1036588204 8:10144606-10144628 AAAAAGCAGGGAGAGGGAAGGGG - Intronic
1037006325 8:13785458-13785480 TAAAAGCAGCCAGAGGAACAGGG + Intergenic
1037058708 8:14479358-14479380 TAAAAGCAGGCGGAGCAAAGAGG - Intronic
1037165773 8:15826721-15826743 CAAAGGCAGGAAGAGGAATGGGG + Intergenic
1037177770 8:15967098-15967120 CAAAAGCAAGCAGAAGAATATGG + Intergenic
1037186149 8:16065790-16065812 TAAAAGCAGGCAGAGGAACGTGG + Intergenic
1037366725 8:18130193-18130215 TAAAAGCAGCAAGAGAAATGAGG + Intergenic
1037391094 8:18392500-18392522 TGAAAGTAGGCAGAAGAATGTGG - Intronic
1037449284 8:19000642-19000664 TAAAAGCAGCCCAGGGAATGGGG + Intronic
1037485044 8:19339207-19339229 TAAAAGCTGGCAGAAGAACGTGG - Intronic
1037689860 8:21172595-21172617 TAAAGCCAGGAAGAGGAAGGAGG + Intergenic
1038089561 8:24238102-24238124 TATAAGGAGGCATAAGAATGTGG + Intergenic
1038117268 8:24571622-24571644 TAAAAGCAGCCAGACAAATTAGG + Intergenic
1039182160 8:34878753-34878775 CAAAGGCAGGCAGAGGAATGGGG - Intergenic
1039264931 8:35814418-35814440 TAAAAGCAAGCAGAGAAACGTGG + Intergenic
1039280027 8:35974460-35974482 TAAAAGCAGGCAGAAGAACTTGG - Intergenic
1039356303 8:36820397-36820419 TAAAGGCTGGAAGAGCAATGAGG + Intronic
1039383879 8:37113385-37113407 TAAAAGCAGGCAGAAGAATGTGG - Intergenic
1039385453 8:37131653-37131675 TAAAAGCAGGCAGAAGAATGTGG - Intergenic
1039419737 8:37426237-37426259 TAAAAGCAGGCAGAAGAACGTGG + Intergenic
1039421405 8:37445261-37445283 TGAAAGCAGTCAGAGGAAAATGG + Intergenic
1039745027 8:40417411-40417433 TAAAAGCAGGCAGAAGAACATGG - Intergenic
1039781436 8:40790073-40790095 CAAAGGCAGGCAGGGGAGTGGGG - Intronic
1039895036 8:41711128-41711150 TAAAAGAGAGCAAAGGAATGGGG + Intronic
1039960619 8:42244473-42244495 TAAAAGAAGTAAAAGGAATGTGG - Intergenic
1041234763 8:55788914-55788936 AAAAAGCAGGCAGATGAGGGAGG - Intronic
1042101465 8:65279746-65279768 TAAAAGCAGGCAGAGAAACATGG - Intergenic
1042388090 8:68201561-68201583 TAAAAGCAGGCAGAAGAACGTGG - Intronic
1042976003 8:74470235-74470257 TAAAAGCAGGCAAAGGAGAGAGG - Intronic
1043099245 8:76019273-76019295 GAAAGGCAGGCAGAAGAATTTGG + Intergenic
1043290374 8:78592791-78592813 AAAAATGAGGCAGAGAAATGTGG - Intronic
1043525969 8:81096957-81096979 TGAAAGCAAACAGAGGGATGAGG + Intronic
1043569608 8:81588041-81588063 TAAAAGCAGGCAGAGGAACGTGG - Intergenic
1043647943 8:82546325-82546347 TAAAAGCAGCAAGAGGAAAATGG - Intergenic
1043716241 8:83490394-83490416 AAAAAGCAGGGAGAAGAAGGTGG - Intergenic
1043972041 8:86541128-86541150 TAAAAGCAGGCAGGATAATGAGG + Intronic
1043981228 8:86642041-86642063 TAAAAGCAGGAAGAGAGAGGGGG - Intronic
1044176075 8:89124404-89124426 TAAAAGCAAGGAGAGTAATTTGG + Intergenic
1044226053 8:89719385-89719407 TGAAAGTTGGCAGTGGAATGAGG - Intergenic
1044233433 8:89804810-89804832 TAAGACCACGCAGGGGAATGAGG - Intergenic
1044286512 8:90416688-90416710 TGAAAGCAGGCAGAGGAACGTGG - Intergenic
1044344671 8:91091540-91091562 ATAAAGCAGGCAGAAGAAAGTGG + Intergenic
1044435195 8:92153686-92153708 TAAAAGCAGGCAGGAGAACATGG + Intergenic
1044458491 8:92416672-92416694 TAAAAGCAGGCAGAGGAACATGG + Intergenic
1044546105 8:93461437-93461459 TAAAAGCAGCCAGAAGAAACGGG + Intergenic
1044557542 8:93579954-93579976 TAAAAGCATGAAGAGGTCTGAGG + Intergenic
1045040352 8:98218410-98218432 TAAAAGTAGGAAGATAAATGGGG + Intronic
1045128848 8:99125358-99125380 ATAAAGCAGGCAGAAGAATGTGG - Intronic
1045588391 8:103564686-103564708 TAAAAGCAGGCAGAAGAACGTGG - Intronic
1045932753 8:107646394-107646416 TAAAAGCAGGTAGAAGAACGTGG - Intergenic
1046066718 8:109205883-109205905 TAAAAGCAGGCAGAAGAACATGG - Intergenic
1046463642 8:114573365-114573387 AAAAAGCAGGCAGAAGAAGGTGG + Intergenic
1046518130 8:115289518-115289540 TAAAAGCAGGGAGAAGAATGTGG - Intergenic
1046675324 8:117101716-117101738 TAAAAGCAGGCAGAAGAATGTGG + Intronic
1046854352 8:119013733-119013755 TTAAAGCAGGGAGAGTAATTAGG - Intronic
1047028830 8:120853740-120853762 TAAAAACAGGCCGAAGAATGTGG - Intergenic
1047196439 8:122726148-122726170 TAAAAGCAGGCAGAAGAACATGG + Intergenic
1047375802 8:124294899-124294921 AAAAAGCAGGCAGAAGAAGGTGG + Intergenic
1047638845 8:126796641-126796663 AAAAAGCAGGCAGAAGAAGAGGG - Intergenic
1048113381 8:131492161-131492183 TAAAAGCAGGCAGAAGAATGTGG + Intergenic
1048120891 8:131580578-131580600 TAAAGGCAGGCATAAGAAAGTGG + Intergenic
1048240681 8:132738714-132738736 TAAAAGCAGGAAGAGGAGAGGGG - Intronic
1048337268 8:133512374-133512396 TAAAAGCAGGCAGAGGAACGTGG - Intronic
1048349040 8:133600849-133600871 TAAGAGCAGGGAGAGAACTGGGG - Intergenic
1048499405 8:134961992-134962014 ATAAAGCAGGCAGAAGAAAGTGG + Intergenic
1048521513 8:135159768-135159790 TAAAAGCAGGCAGAAGAACATGG + Intergenic
1048573155 8:135671468-135671490 GAGACGCAGGCAGAGGAAGGTGG + Intergenic
1048625853 8:136184258-136184280 TAAAAGCAGGCAGAATAATTTGG - Intergenic
1048634820 8:136284496-136284518 ATAAAGCAGGCAGAGGAACATGG - Intergenic
1048737787 8:137520732-137520754 CAAAAGCAGGCAAAGGAACGTGG + Intergenic
1048746949 8:137624988-137625010 TAAAAGCAGGCAGAGGAACGAGG - Intergenic
1048868243 8:138776480-138776502 TAAAGGCAGGATGAGCAATGGGG - Intronic
1048869227 8:138783493-138783515 TATAAGCAGGCAGAAAAATGTGG - Intronic
1048895114 8:138985216-138985238 AAAAAGCAGGCAGGAGAAGGTGG + Intergenic
1048916448 8:139188709-139188731 TAAAAGCAGGCAGAGGAACGTGG - Intergenic
1048952818 8:139510231-139510253 TAAAAGCAGGCAGAGGAACGTGG - Intergenic
1049737179 8:144214992-144215014 TAAATGCGGGAAGAAGAATGTGG - Intronic
1050045990 9:1545678-1545700 AAAAAGCAAGCAGAAGAAGGTGG - Intergenic
1050303809 9:4286173-4286195 TTAAGGCAGGCAGATGGATGCGG + Exonic
1050483013 9:6105281-6105303 TATAAGCAGGCAGAAAAATATGG + Intergenic
1050529328 9:6574688-6574710 AAAAAGCAGGGTGAGGGATGAGG - Intronic
1050620075 9:7442875-7442897 TAAAAGCAGGCAGAGGAACGTGG - Intergenic
1050991010 9:12152131-12152153 ATAAAGCAGGCAGAAGAAAGTGG + Intergenic
1051011224 9:12416756-12416778 TAAAAGCAGGCAGAGGCACATGG - Intergenic
1051227601 9:14918277-14918299 TAAAAGCAGGTAGAAGAATGTGG - Intergenic
1051299704 9:15635510-15635532 ATAAAGCAGGCAGAAGAAAGTGG - Intronic
1051551676 9:18337168-18337190 TAAAAGCAGGCTGAAGAACGTGG + Intergenic
1051716607 9:19991366-19991388 TAAAAGCAGGCAGAAGAACATGG - Intergenic
1051729572 9:20126167-20126189 AAAATGCAGGCAGAGGACTTTGG - Intergenic
1051946853 9:22579849-22579871 TAAAAGCAGCCAAAGGAAAGGGG - Intergenic
1052173476 9:25429007-25429029 AAAAAGAAGGAAAAGGAATGAGG + Intergenic
1052206128 9:25843033-25843055 ACAAAGCAGGCAGAGGTCTGGGG + Intergenic
1052556663 9:30027315-30027337 TAAAAGCAGGCAGAGGAATGTGG - Intergenic
1052587691 9:30450278-30450300 TAAAAGCAGGCAGAGGAACATGG + Intergenic
1052689608 9:31801029-31801051 TAAAAGCAGCAAGAGGAGAGAGG + Intergenic
1052718173 9:32144237-32144259 TAAAAGCAGGCAGAGGAACGTGG + Intergenic
1052785342 9:32822941-32822963 AAAAAGCAGGCAGAAGAAGGTGG + Intergenic
1052789437 9:32860912-32860934 AAAAAGCAGGCAGAAAAAGGTGG - Intergenic
1052819998 9:33130878-33130900 CAGAAGCAGGCAGAGGAAGCAGG + Intronic
1052984802 9:34479063-34479085 TGGAAGCAGGGAGAGGAAAGGGG + Intronic
1053034542 9:34813213-34813235 TAAAGGCAAGCAGAGGTAGGAGG - Intergenic
1053086407 9:35226712-35226734 TAAAAGCAGGCAGAGGAACGCGG - Intronic
1053127980 9:35598467-35598489 TAAAAGCAGTTAAATGAATGTGG - Intergenic
1053361702 9:37492258-37492280 TAAAAGCAGGCATAAACATGAGG - Intronic
1053571090 9:39308430-39308452 TAATAGAAGGCAGAAGAAAGTGG + Intergenic
1053571846 9:39318087-39318109 AAAAAGAAGACAGAAGAATGTGG + Intergenic
1053582818 9:39424813-39424835 ATAAAGCAGGCAGGAGAATGTGG + Intergenic
1053622374 9:39832921-39832943 AAAAAGAAGACAGAAGAATGTGG + Intergenic
1053836978 9:42149038-42149060 TAACAGAAGGCAGAAGAAAGTGG + Intergenic
1053847004 9:42249678-42249700 ATAAAGCAGGCAGGAGAATGTGG + Intergenic
1053882765 9:42612259-42612281 AAAAAGAAGACAGAAGAATGTGG - Intergenic
1053889904 9:42682043-42682065 AAAAAGAAGACAGAAGAATGTGG + Intergenic
1054092653 9:60867132-60867154 TAATAGAAGGCAGAAGAAAGTGG + Intergenic
1054093400 9:60876798-60876820 AAAAAGAAGACAGAAGAATGTGG + Intergenic
1054104397 9:60983556-60983578 ATAAAGCAGGCAGGAGAATGTGG + Intergenic
1054114126 9:61143037-61143059 TAATAGAAGGCAGAAGAAAGTGG + Intergenic
1054114883 9:61152718-61152740 AAAAAGAAGACAGAAGAATGTGG + Intergenic
1054125299 9:61300924-61300946 AAAAAGAAGACAGAAGAATGTGG - Intergenic
1054126055 9:61310582-61310604 TAATAGAAGGCAGAAGAAAGTGG - Intergenic
1054221792 9:62419727-62419749 AAAAAGAAGACAGAAGAATGTGG - Intergenic
1054228922 9:62489446-62489468 AAAAAGAAGACAGAAGAATGTGG + Intergenic
1054354841 9:64050470-64050492 ACAAAGCAGGCAGAGGAAGGTGG + Intergenic
1054581947 9:66923294-66923316 ATAAAGCAGGCAGGAGAATGTGG - Intronic
1054592873 9:67029816-67029838 AAAAAGAAGACAGAAGAATGTGG - Intergenic
1054593629 9:67039466-67039488 TAATAGAAGGCAGAAGAAAGTGG - Intergenic
1054832617 9:69643549-69643571 AAGAAGGAGGGAGAGGAATGAGG - Intronic
1055154095 9:73039359-73039381 TAAACTCAGGCAGAGGACAGGGG - Intronic
1055177974 9:73343953-73343975 TAAAAGAAGAGAGAGGAAAGGGG - Intergenic
1055533937 9:77216913-77216935 TAAAAGCAGGCAGATGAACATGG - Intronic
1055585569 9:77756022-77756044 TCAAAGCAGGCAGAAGAACATGG + Intronic
1055723725 9:79204673-79204695 TAAAAGATGACAGAGGAATAAGG + Intergenic
1055865505 9:80808681-80808703 TAAAAGCAGGCAGAGGAACATGG + Intergenic
1055907131 9:81307971-81307993 TAAAGGCAGGCAGAGGAATGTGG - Intergenic
1056079155 9:83072718-83072740 TAAAAGCAGGCAGAAGAAAGTGG - Intergenic
1056185925 9:84134842-84134864 TAAAAGCAGGCAAAAAAATGTGG + Intergenic
1056189830 9:84173906-84173928 TAAAACAAAGGAGAGGAATGAGG + Intergenic
1056435424 9:86571106-86571128 AAAAAGCAGGCAGAAGAAGGTGG + Intergenic
1056649596 9:88447003-88447025 AAAGAGCAGAGAGAGGAATGAGG - Intronic
1057188296 9:93071482-93071504 TAAAAGCAGGCAGAGGAACGTGG - Intronic
1057548877 9:96037774-96037796 TAGAAAGAAGCAGAGGAATGAGG + Intergenic
1057866383 9:98685111-98685133 TAAAAGCAGGCAGAGGAAAATGG + Intronic
1057872401 9:98728351-98728373 TAAGAGCAGGCAGAGGAGCTGGG - Intergenic
1058094781 9:100847167-100847189 AAAAAGCAGGCAGAAGAAGGTGG - Intergenic
1058229953 9:102413365-102413387 ATAAAGCAGGCAGAAGAACGTGG - Intergenic
1058302524 9:103393811-103393833 TAAAAGCAGGCAGAGGAACATGG - Intergenic
1058355847 9:104082851-104082873 TAAAAGCAGGCAGAGAAATGTGG - Intergenic
1058543779 9:106039600-106039622 TAAAAGCAGGCAGAAGAACGTGG + Intergenic
1058649806 9:107164693-107164715 TAAAAGCAGGCAGAAGAATATGG + Intergenic
1058735677 9:107891840-107891862 TCAAAGCAAGCTGAGGAATTTGG - Intergenic
1059352632 9:113676545-113676567 TAAGAGAAGCCAGAGGAAAGGGG + Intergenic
1059562163 9:115346383-115346405 ATAAAGCAGGCAGAAGAACGTGG + Intronic
1059580788 9:115546314-115546336 TAAAAGCAGGCAGAGGAACGTGG + Intergenic
1059805710 9:117798247-117798269 TAAAACCAGGCAGAGGCAGCTGG - Intergenic
1059880963 9:118688309-118688331 AAAAAGCAGGCAGAAGAATGTGG + Intergenic
1059881700 9:118697460-118697482 TAAAAACAGGCAGAGAAATGTGG - Intergenic
1059888992 9:118779992-118780014 TAAGAGCAGGCAAAGGAGCGTGG + Intergenic
1060007471 9:120013484-120013506 AAAAAGCAGGCAGAGGAATGTGG + Intergenic
1060306661 9:122419765-122419787 TATAAGAAGGCATGGGAATGTGG - Intergenic
1060886432 9:127155700-127155722 CAAAAGCAGGGAGATGTATGAGG + Intronic
1061467277 9:130791555-130791577 ACAAAGCAGGCAGAAGAAGGTGG + Intronic
1061656464 9:132095031-132095053 GGAAAGCAGGCAGAAGAAGGTGG - Intergenic
1062179239 9:135181889-135181911 ATAAATCAGGCAGAGGAAGGTGG + Intergenic
1062184141 9:135207663-135207685 ACAAAGCAGGCAGAAGAAGGTGG + Intergenic
1062372562 9:136247545-136247567 CCAAAGCAACCAGAGGAATGGGG + Intergenic
1203743178 Un_GL000218v1:19600-19622 ACAAAGCAGGCAGAGGAAGGTGG + Intergenic
1203566925 Un_KI270744v1:99915-99937 ACAAAGCAGGCGGAGGAAGGTGG - Intergenic
1185524134 X:763986-764008 TAGAAGCAGGCAGAGGTTGGTGG + Intergenic
1185662255 X:1736670-1736692 GAAAAGCAGGCACAAGAATTGGG + Intergenic
1185742474 X:2544875-2544897 TAAAAGCAGGCAGAGGAACATGG + Intergenic
1185849134 X:3469001-3469023 TAAAAGTAGGCAGAGGAATGTGG + Intergenic
1185934080 X:4235988-4236010 TAGAAGCAGGCAGAGGAACGTGG + Intergenic
1185950502 X:4427255-4427277 TAAAGACAGGCAGAGGAATGTGG + Intergenic
1185958495 X:4519251-4519273 AAAAAGCAGTCAGAAGAAGGTGG - Intergenic
1185989346 X:4875660-4875682 TAAAAACAGACAGAAGAATATGG + Intergenic
1185995940 X:4949455-4949477 TAAAAGCAGGCAGAAGAACGTGG + Intergenic
1186006582 X:5078762-5078784 TAAAAGCAGGCAGAAGAACCTGG - Intergenic
1186055295 X:5643509-5643531 AAAAAGCAGGCAGAGGAACATGG - Intergenic
1186139409 X:6555210-6555232 TAAATGCAGGCAGAAGAACATGG + Intergenic
1186151260 X:6676931-6676953 TAAAAGCAGGCGGAAGAACGTGG + Intergenic
1186183202 X:6992874-6992896 TAAAAGCAGGTAGAGGAACATGG + Intergenic
1186217515 X:7315775-7315797 ATAAAGCAGGCAGAAGAACGTGG - Intronic
1186304597 X:8242039-8242061 TAAAAGCAGGCAGAAGAACGTGG - Intergenic
1186334793 X:8574551-8574573 TAAAAGCAGGGAGAAGAATGTGG + Intronic
1186342649 X:8660310-8660332 CAGGAGAAGGCAGAGGAATGGGG - Intronic
1186558723 X:10588192-10588214 TATAAGGAGGCATAAGAATGTGG - Intronic
1187241139 X:17514325-17514347 ATAAAGCAGGCAGAAGAATGTGG + Intronic
1187319529 X:18227351-18227373 TAAAAGCAGGCAGAAGAGCATGG - Intergenic
1187575738 X:20552754-20552776 CAAAAGCAGGCAGAGGAACATGG - Intergenic
1187604417 X:20868408-20868430 TAAAAGCAGGTCGAGGAATGTGG + Intergenic
1187642701 X:21312471-21312493 TACAAGCAGGTAGAGGAATGTGG + Intergenic
1187840209 X:23479215-23479237 ACAAAGCAGGCAGAAGAAGGTGG + Intergenic
1187887704 X:23905009-23905031 TAGGAGTAGGCAGAGGAAAGGGG - Intronic
1188002166 X:24993468-24993490 TCAAAGCAGGAAAAGGAATCAGG + Intronic
1188012587 X:25073579-25073601 ATAAAGCAGGCAGAGGAACATGG - Intergenic
1188054148 X:25522259-25522281 AAAAAGCAGGCAGAAGAAGGTGG + Intergenic
1188151322 X:26679702-26679724 TATAAGCAGGTAGAAAAATGTGG + Intergenic
1188387183 X:29575513-29575535 ACAAAGCAGGCAGAAGAAGGTGG - Intronic
1188641080 X:32505512-32505534 CAAAAGCCGACAGAGAAATGGGG + Intronic
1188707599 X:33355243-33355265 TAAAAACAGGCAGAGGAACATGG + Intergenic
1188771689 X:34161317-34161339 AAAAAGCAGGCAGAAGGAGGTGG + Intergenic
1188786527 X:34353322-34353344 TAAAATCAGGCAGAAGAATGTGG + Intergenic
1188797328 X:34482409-34482431 AAAAAGCAGGTAGAAGAAAGTGG + Intergenic
1188848578 X:35104145-35104167 ATAAAGCAGGCAGAAGAATGTGG + Intergenic
1189034455 X:37481452-37481474 TATAAGGAGGCATAAGAATGTGG + Intronic
1189086371 X:38029317-38029339 TATAAGAAGTCATAGGAATGTGG - Intronic
1189286114 X:39853634-39853656 GAAAAGCAGGCAGAGGAGAAGGG + Intergenic
1189703574 X:43736922-43736944 TAAAAGCTAGCAGAGGATTTAGG - Intronic
1189873198 X:45405503-45405525 TAAATGCAGCTAGAGGAAAGGGG + Intergenic
1189947141 X:46191026-46191048 TCAAGGCAGCCAGAGAAATGTGG + Intergenic
1190137580 X:47811092-47811114 TATAAGAAGGCATGGGAATGTGG - Intergenic
1190959404 X:55230561-55230583 AAAAAGCAGGCAGAAGAAGGTGG - Intronic
1191095424 X:56668672-56668694 ATAAAGCAGGCAGAGGAAACTGG - Intergenic
1191206520 X:57839931-57839953 AAAAAGCAGGCAGAAGAACGTGG + Intergenic
1191226142 X:58045100-58045122 ATAAAGCAGGCAGAAGAAGGTGG + Intergenic
1191719708 X:64219314-64219336 ATAAAGCAGGCAGAAGAACGTGG - Intergenic
1191732444 X:64351824-64351846 AAAAAGCAGGCAGAAGAAGGTGG - Intronic
1191919866 X:66244079-66244101 TAAAGGCAGATAGAGGAAAGGGG - Intronic
1191988061 X:67003349-67003371 AAAAAGCAGGCAGAAAAATGTGG - Intergenic
1192459421 X:71304252-71304274 TAAACGCAGGAAGTGGAATCTGG - Exonic
1192675479 X:73191576-73191598 AAAAAGCAGGCAGAAGAAAATGG + Intergenic
1192728816 X:73781571-73781593 ATAAAGCAGGCAGAAGAAGGTGG - Intergenic
1192915572 X:75647840-75647862 TATAAGGAGGCATAAGAATGTGG - Intergenic
1192995799 X:76512034-76512056 TAAAAGCAGGCAGAAGAATGTGG + Intergenic
1192996485 X:76518141-76518163 TAAAAGCAGGCAGAAGAATGTGG + Intergenic
1193324576 X:80164805-80164827 TAAAAGCAGGCAGAAGAACATGG - Intergenic
1193354937 X:80508256-80508278 AAAAAGCAGGCAGGGAAACGTGG - Intergenic
1193360717 X:80575408-80575430 TAAAGGCAGACAGAGAAAAGGGG - Intergenic
1193391572 X:80935425-80935447 TAAAAGTAGGCAGAAGAATGTGG + Intergenic
1193413561 X:81195348-81195370 TAAAAGCAGGCAAAGGAACATGG - Intronic
1193444529 X:81583974-81583996 TAAAAGCAGGTAGAAGAACGTGG - Intergenic
1193450188 X:81655861-81655883 AAAAAGCAGGCAGAAAAAGGTGG - Intergenic
1193472910 X:81928381-81928403 TAAAAGCAAGCAGAAAAATGTGG - Intergenic
1193533290 X:82682489-82682511 TAAAAGGAGGGAGAGGGAGGGGG + Intergenic
1193717238 X:84947244-84947266 TATAAGGAGGCATAAGAATGTGG + Intergenic
1193792914 X:85838173-85838195 ATAAAGCAGGCAGAAGAAAGTGG - Intergenic
1193905045 X:87232020-87232042 TAAAAGTGGGCAGAGGAACGTGG - Intergenic
1193915318 X:87355862-87355884 ATAAAGTAGGCAGAAGAATGTGG - Intergenic
1194064693 X:89247282-89247304 AAAAAGCGGGCAGAAGAAAGTGG + Intergenic
1194137503 X:90164512-90164534 TAAAAGCAGGCAGAGGAACATGG + Intergenic
1194159682 X:90435287-90435309 TATAAGAAGGCATGGGAATGTGG - Intergenic
1194180118 X:90700615-90700637 AAAAAGGAGGCAGAAGAAGGTGG - Intergenic
1194277112 X:91899335-91899357 TAAAAGCAGGCAGAAGAAACTGG - Intronic
1194343766 X:92736410-92736432 TAAAAGTAGCCAGAGGAAAAAGG + Intergenic
1194531259 X:95051932-95051954 GAAAAACAGGCAGAAGAAGGTGG + Intergenic
1194591061 X:95800313-95800335 CAAAAGCAGGCAGATGAAGGTGG + Intergenic
1194676704 X:96803010-96803032 TAGAAGCAGGCAGAGGAAGGTGG - Intronic
1194885481 X:99310747-99310769 TAAAAGCAGGCAGAGGAATGTGG - Intergenic
1195123968 X:101786679-101786701 AAAAAGCAGACAGAAGAAGGTGG - Intergenic
1195172738 X:102284991-102285013 TAAAAGCAGCCAGAGAGAAGGGG - Intergenic
1195186128 X:102402104-102402126 TAAAAGCAGCCAGAGAGAAGGGG + Intronic
1195271667 X:103237212-103237234 TAAAAGCAGGCAGAGGAATGTGG - Intergenic
1195309202 X:103614493-103614515 TAAAAGTAGGCAGAGGAACGTGG + Intronic
1195437727 X:104864697-104864719 ATAAAGCAGGCAGAAGAAAGTGG + Intronic
1195468337 X:105205692-105205714 GAAAAGCAGGCAGAGAACAGAGG + Intronic
1195472065 X:105241861-105241883 TATAAGAAGGCATGGGAATGTGG - Intronic
1195850460 X:109276947-109276969 AAAAAGCAGGCAGAAGAAGGTGG + Intergenic
1195877126 X:109553173-109553195 TATAAGAAGTCATAGGAATGTGG + Intergenic
1195999685 X:110768557-110768579 AAAAAGCAGGTAGAAGAAGGTGG + Intronic
1196026280 X:111044540-111044562 TAGAAACAGGGAGAGGGATGTGG + Intronic
1196162157 X:112497833-112497855 TATAAGAAGGCATGGGAATGTGG - Intergenic
1196230748 X:113218072-113218094 TAAAAGCAGGCAGAGGAACATGG - Intergenic
1196534690 X:116829395-116829417 AAAAAGCAGGCAGAGGAACATGG + Intergenic
1196666700 X:118324805-118324827 TAAAAGCAGGCAGAAGAGCGTGG + Intergenic
1196933922 X:120710252-120710274 TAAAAGCAGACAGAAGAACGTGG + Intergenic
1197082551 X:122437535-122437557 TAAAAGCAGGCAGAAGAACGTGG - Intergenic
1197084659 X:122457154-122457176 ATAAAGCAGGCAAAAGAATGTGG - Intergenic
1197372459 X:125641506-125641528 TTAAAGCAGGCAGAAGAAGATGG - Intergenic
1197388408 X:125828662-125828684 ATAAAGCAGGCAGAAGAACGTGG + Intergenic
1197481220 X:126988939-126988961 TATAAGGAGGCACAGGAATGTGG + Intergenic
1197537646 X:127709323-127709345 ATAAAGCAGGCAGAAGAAGGTGG + Intergenic
1197596603 X:128471335-128471357 TAAAAGCAGGCAGAGGAACATGG + Intergenic
1197912713 X:131501892-131501914 TAAAAGCAGGCAGAAGAACGTGG - Intergenic
1198012448 X:132572199-132572221 TAAAAGCAGGCAGAGGAACGTGG - Intergenic
1198132771 X:133715129-133715151 ATAAAGCAGGCAGAAGAATGTGG + Intronic
1198716791 X:139566285-139566307 TCACAGCAGGCAAAGGACTGTGG + Intergenic
1198742366 X:139854752-139854774 TATAAGGAGGCATAAGAATGTGG + Intronic
1198786063 X:140289599-140289621 TAAAAGCAGGCAGAATAACGTGG + Intergenic
1198869051 X:141156523-141156545 AAGAAGCAGGCAGAGGAACGTGG + Intergenic
1198956599 X:142138126-142138148 TAAAAGCAGCAAGAGAAAAGAGG + Intergenic
1198994536 X:142559381-142559403 CAAAGGCAGGCAGAAGAGTGGGG - Intergenic
1199046684 X:143182573-143182595 TAAAAGCAGGCAGACGAACGTGG + Intergenic
1199111098 X:143935848-143935870 AAAAAGCAAGCAGAAGAAGGTGG + Intergenic
1199154006 X:144525038-144525060 TAAAAGCAGGCAGAAGAAGTTGG + Intergenic
1199275601 X:145938768-145938790 TAAAAGCAGGCAGAGGACAATGG + Intergenic
1199287576 X:146070943-146070965 TCAAAGCAGCCACAGGAAAGGGG - Intergenic
1199534036 X:148881679-148881701 TAGAGGCTGGCAGAGGAATCAGG - Intronic
1199732255 X:150646963-150646985 TAAAAGCATGCATGGGGATGGGG - Intronic
1199784866 X:151096078-151096100 AAAAAGCAGGCAGAAGAAGGTGG - Intergenic
1199785277 X:151099608-151099630 TAAAAGCAGACAGAGGAACGTGG + Intergenic
1199994571 X:153013343-153013365 TAAAAGAAGGCATGAGAATGTGG - Intergenic
1200015902 X:153163692-153163714 CAAAAGCAGGCAGAAGAAGGTGG - Intergenic
1200073820 X:153541578-153541600 TGGAAGGAGGAAGAGGAATGGGG + Intronic
1200483233 Y:3734448-3734470 TAAAAGCAGGCAGAGGAACATGG + Intergenic
1200505984 Y:4012253-4012275 TATAAGAAGGCATGGGAATGTGG - Intergenic
1200526775 Y:4282783-4282805 AAAAAGGAGGCAGAAGAAGGTGG - Intergenic
1200594457 Y:5121436-5121458 TAAAAGCAGGCAGAAGAAACTGG - Intronic
1200652120 Y:5853073-5853095 TAAAAGTAGCCAGAGGAAAAAGG + Intergenic
1200763381 Y:7060183-7060205 TATAAGGAGGCATAAGAATGTGG - Intronic
1200814521 Y:7517797-7517819 TAAAAGCAGGCAGAGGAACAAGG - Intergenic
1201156707 Y:11137067-11137089 ACAAAGCAGGCAGAGGAAGGTGG + Intergenic
1201424589 Y:13834155-13834177 CAGGAGAAGGCAGAGGAATGGGG + Intergenic
1201632345 Y:16082934-16082956 TATAAGGAGGCATAAGAATGTGG + Intergenic
1201674308 Y:16562042-16562064 TAAAAACAGGCAGAGGAATGTGG + Intergenic
1201685998 Y:16703057-16703079 AAAAAGCAGGCAGAAGAAGGTGG - Intergenic
1201714942 Y:17034171-17034193 TAAAAGCAGGCAGAGGAAGGTGG + Intergenic